Mutagenetix > Incidental Mutation

Incidental Mutation 'R6468:Gak'

516421

Institutional Source

Beutler Lab

Gene Symbol

Gak

Ensembl Gene

ENSMUSG00000062234

Gene Name

cyclin G associated kinase

Synonyms

D130045N16Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6468 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108569411-108629755 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 108623336 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 102 (C102*)

Ref Sequence

ENSEMBL: ENSMUSP00000118713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046603] [ENSMUST00000135225] [ENSMUST00000145467] [ENSMUST00000199048] [ENSMUST00000199662]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000046603
AA Change: C102*

SMART Domains

Protein: ENSMUSP00000036705
Gene: ENSMUSG00000062234
AA Change: C102*

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
Pfam:Pkinase	40	313	1.6e-49	PFAM
Pfam:Pkinase_Tyr	40	313	3e-30	PFAM
PTEN_C2	568	707	1.43e-44	SMART
low complexity region	819	833	N/A	INTRINSIC
low complexity region	932	945	N/A	INTRINSIC
low complexity region	1084	1092	N/A	INTRINSIC
low complexity region	1094	1110	N/A	INTRINSIC
DnaJ	1240	1301	2.3e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000135225
AA Change: C102*

SMART Domains

Protein: ENSMUSP00000118008
Gene: ENSMUSG00000062234
AA Change: C102*

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
Pfam:Pkinase	40	128	7.9e-11	PFAM
Pfam:Pkinase_Tyr	40	128	1.2e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137872

Predicted Effect

probably null
Transcript: ENSMUST00000145467
AA Change: C102*

SMART Domains

Protein: ENSMUSP00000118713
Gene: ENSMUSG00000062234
AA Change: C102*

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
Pfam:Pkinase	40	128	7.9e-11	PFAM
Pfam:Pkinase_Tyr	40	128	1.2e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145935

Predicted Effect

probably benign
Transcript: ENSMUST00000199048

SMART Domains

Protein: ENSMUSP00000142931
Gene: ENSMUSG00000062234

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
PDB:4O38\|B	23	69	3e-10	PDB
SCOP:d1koba_	41	69	3e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199662

SMART Domains

Protein: ENSMUSP00000143646
Gene: ENSMUSG00000062234

Domain	Start	End	E-Value	Type
low complexity region	11	22	N/A	INTRINSIC
low complexity region	33	50	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

97% (57/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In all eukaryotes, the cell cycle is governed by cyclin-dependent protein kinases (CDKs), whose activities are regulated by cyclins and CDK inhibitors in a diverse array of mechanisms that involve the control of phosphorylation and dephosphorylation of Ser, Thr or Tyr residues. Cyclins are molecules that possess a consensus domain called the 'cyclin box.' In mammalian cells, 9 cyclin species have been identified, and they are referred to as cyclins A through I. Cyclin G is a direct transcriptional target of the p53 tumor suppressor gene product and thus functions downstream of p53. GAK is an association partner of cyclin G and CDK5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a deletion of the kinase domain display neonatal lethality with abnormal lung alveolar morphology and development. Mice homozygous for a knock-out allele exhibit lethality during early development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	G	T	10: 82,295,316	T620K	probably benign	Het
4932438A13Rik	T	C	3: 37,008,443	I3368T	probably damaging	Het
Adamtsl5	A	G	10: 80,341,913	V305A	possibly damaging	Het
Adgrl4	A	G	3: 151,492,375	T91A	probably benign	Het
Ano6	A	G	15: 95,967,714	I860V	probably benign	Het
B3galnt1	A	G	3: 69,575,533	S132P	probably damaging	Het
Btbd10	A	T	7: 113,347,059	V33E	probably benign	Het
Cacna1g	A	T	11: 94,439,722	V989D	probably damaging	Het
Celsr3	A	G	9: 108,835,790	D1807G	probably benign	Het
Chd6	A	G	2: 161,013,067	M807T	probably damaging	Het
Cpxm2	T	C	7: 132,070,860	D320G	probably damaging	Het
Cryzl1	A	C	16: 91,692,525		probably null	Het
Dcbld2	A	T	16: 58,433,373	K158*	probably null	Het
Depdc5	A	G	5: 32,912,231	N437S	probably benign	Het
Dock7	G	A	4: 98,967,227	S1496L	probably benign	Het
Eea1	T	G	10: 96,028,412	I931R	probably benign	Het
Eif2ak4	C	A	2: 118,436,241	L714I	probably damaging	Het
Enpep	A	G	3: 129,331,860		probably null	Het
Fam83b	T	A	9: 76,502,131	K238*	probably null	Het
Fam83f	A	G	15: 80,692,111	Y321C	possibly damaging	Het
Fanci	A	G	7: 79,417,939	I42V	probably benign	Het
Flg2	A	T	3: 93,214,421	R1299S	unknown	Het
Gcnt7	A	G	2: 172,454,073	L277P	probably damaging	Het
Gucy2d	A	G	7: 98,449,961	E329G	probably benign	Het
Hacd1	T	C	2: 14,035,944	I167V	probably damaging	Het
Hdlbp	T	A	1: 93,417,667	D662V	possibly damaging	Het
Hspa4	A	T	11: 53,265,056	V674E	probably benign	Het
Hunk	A	G	16: 90,493,432	Q442R	possibly damaging	Het
Lce1j	A	T	3: 92,789,422	C16*	probably null	Het
Lrat	A	T	3: 82,903,492	M74K	probably damaging	Het
Lrig2	G	A	3: 104,467,193	R191C	probably damaging	Het
Lrrc37a	A	C	11: 103,460,840	F2558L	unknown	Het
Mctp1	T	A	13: 76,731,811		probably null	Het
Mecom	T	A	3: 30,140,386		probably benign	Het
Mgst1	A	G	6: 138,141,587		probably null	Het
Ms4a15	T	G	19: 10,993,170	E3A	probably benign	Het
Myo1d	T	C	11: 80,557,474	I942V	probably benign	Het
Neu2	A	G	1: 87,596,878	Y195C	probably damaging	Het
Nipa1	A	T	7: 56,019,504	V22E	probably benign	Het
Olfr1061	T	A	2: 86,414,037	N5I	probably damaging	Het
Olfr733	A	T	14: 50,298,467	L281I	probably benign	Het
Olfr781	T	C	10: 129,333,711	S277P	possibly damaging	Het
Pik3r4	A	G	9: 105,685,190	T1223A	possibly damaging	Het
Ppl	T	C	16: 5,092,441	D811G	probably damaging	Het
Prep	T	A	10: 45,115,107	Y290N	probably damaging	Het
Ptk6	A	T	2: 181,199,102	H215Q	probably benign	Het
Rad50	A	G	11: 53,692,144	I474T	possibly damaging	Het
Rnf213	T	A	11: 119,452,687	V3626E	possibly damaging	Het
Scn4a	C	T	11: 106,345,676	V253M	probably damaging	Het
Snta1	T	A	2: 154,377,149	D422V	probably damaging	Het
Stk38	A	G	17: 28,984,112	L160P	probably benign	Het
Tapbp	T	C	17: 33,926,098	F323S	probably damaging	Het
Uggt1	C	T	1: 36,173,450	R937Q	probably benign	Het
Vash2	G	A	1: 190,978,287	P57L	probably damaging	Het
Vmn1r4	G	A	6: 56,956,867	V119I	probably benign	Het
Vmn2r74	T	C	7: 85,961,391	D31G	probably benign	Het
Zfp114	T	C	7: 24,177,781	V16A	possibly damaging	Het

Other mutations in Gak

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Gak	APN	5	108613634	makesense	probably null
IGL00768:Gak	APN	5	108576654	missense	probably benign
IGL01128:Gak	APN	5	108592370	missense	probably damaging	0.97
IGL01557:Gak	APN	5	108584337	missense	probably damaging	1.00
IGL02559:Gak	APN	5	108584232	missense	probably null	0.07
PIT4449001:Gak	UTSW	5	108580925	missense	probably benign	0.00
R0030:Gak	UTSW	5	108613547	nonsense	probably null
R1403:Gak	UTSW	5	108591145	missense	probably damaging	1.00
R1403:Gak	UTSW	5	108591145	missense	probably damaging	1.00
R1530:Gak	UTSW	5	108624193	missense	probably damaging	0.97
R1646:Gak	UTSW	5	108602854	missense	probably damaging	1.00
R1699:Gak	UTSW	5	108604377	nonsense	probably null
R1702:Gak	UTSW	5	108606376	splice site	probably null
R1732:Gak	UTSW	5	108576582	missense	probably benign	0.28
R1738:Gak	UTSW	5	108616976	missense	probably damaging	1.00
R1772:Gak	UTSW	5	108606892	missense	probably damaging	1.00
R1792:Gak	UTSW	5	108585531	nonsense	probably null
R2068:Gak	UTSW	5	108570225	missense	probably benign
R2137:Gak	UTSW	5	108606877	splice site	probably null
R2138:Gak	UTSW	5	108606877	splice site	probably null
R2139:Gak	UTSW	5	108606877	splice site	probably null
R2904:Gak	UTSW	5	108624214	missense	possibly damaging	0.70
R3080:Gak	UTSW	5	108613602	missense	possibly damaging	0.90
R3773:Gak	UTSW	5	108582672	missense	probably benign	0.00
R4523:Gak	UTSW	5	108576566	missense	probably benign	0.22
R4665:Gak	UTSW	5	108582960	missense	probably benign
R4703:Gak	UTSW	5	108569877	missense	probably damaging	0.99
R4890:Gak	UTSW	5	108580876	unclassified	probably benign
R4951:Gak	UTSW	5	108582718	missense	probably benign
R4971:Gak	UTSW	5	108596806	missense	probably damaging	1.00
R5328:Gak	UTSW	5	108617001	missense	possibly damaging	0.94
R5436:Gak	UTSW	5	108592352	missense	possibly damaging	0.94
R5496:Gak	UTSW	5	108576617	missense	probably benign	0.00
R6207:Gak	UTSW	5	108625029	critical splice donor site	probably null
R6359:Gak	UTSW	5	108571900	missense	probably damaging	1.00
R6682:Gak	UTSW	5	108598876	missense	probably damaging	1.00
R6915:Gak	UTSW	5	108602950	missense	probably benign	0.20
R7403:Gak	UTSW	5	108613535	missense	probably benign	0.00
R7458:Gak	UTSW	5	108583074	missense	probably benign	0.00
R7522:Gak	UTSW	5	108591199	missense	possibly damaging	0.95
R7650:Gak	UTSW	5	108584295	missense	probably benign	0.00
R7737:Gak	UTSW	5	108617008	missense	probably benign	0.15
R8437:Gak	UTSW	5	108609406	missense	probably benign	0.30
R8739:Gak	UTSW	5	108591738	missense	possibly damaging	0.65
R8954:Gak	UTSW	5	108629652	start gained	probably benign
X0064:Gak	UTSW	5	108613533	nonsense	probably null
Z1177:Gak	UTSW	5	108585352	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TAGCTGGCTGGCTCTTTCAG -3'
(R):5'- AGAGGGCTTCTGTCTCTGTC -3'

Sequencing Primer
(F):5'- TCTTTCAGGCAAGAGCAATGC -3'
(R):5'- ACTCATATCTAGCATTTCCACTAGG -3'

Posted On

2018-05-21