Incidental Mutation 'R6468:Gak'
ID516421
Institutional Source Beutler Lab
Gene Symbol Gak
Ensembl Gene ENSMUSG00000062234
Gene Namecyclin G associated kinase
SynonymsD130045N16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6468 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location108569411-108629755 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 108623336 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 102 (C102*)
Ref Sequence ENSEMBL: ENSMUSP00000118713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046603] [ENSMUST00000135225] [ENSMUST00000145467] [ENSMUST00000199048] [ENSMUST00000199662]
Predicted Effect probably null
Transcript: ENSMUST00000046603
AA Change: C102*
SMART Domains Protein: ENSMUSP00000036705
Gene: ENSMUSG00000062234
AA Change: C102*

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Pkinase 40 313 1.6e-49 PFAM
Pfam:Pkinase_Tyr 40 313 3e-30 PFAM
PTEN_C2 568 707 1.43e-44 SMART
low complexity region 819 833 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
low complexity region 1084 1092 N/A INTRINSIC
low complexity region 1094 1110 N/A INTRINSIC
DnaJ 1240 1301 2.3e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135225
AA Change: C102*
SMART Domains Protein: ENSMUSP00000118008
Gene: ENSMUSG00000062234
AA Change: C102*

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Pkinase 40 128 7.9e-11 PFAM
Pfam:Pkinase_Tyr 40 128 1.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137872
Predicted Effect probably null
Transcript: ENSMUST00000145467
AA Change: C102*
SMART Domains Protein: ENSMUSP00000118713
Gene: ENSMUSG00000062234
AA Change: C102*

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:Pkinase 40 128 7.9e-11 PFAM
Pfam:Pkinase_Tyr 40 128 1.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145935
Predicted Effect probably benign
Transcript: ENSMUST00000199048
SMART Domains Protein: ENSMUSP00000142931
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
PDB:4O38|B 23 69 3e-10 PDB
SCOP:d1koba_ 41 69 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199662
SMART Domains Protein: ENSMUSP00000143646
Gene: ENSMUSG00000062234

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
low complexity region 33 50 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In all eukaryotes, the cell cycle is governed by cyclin-dependent protein kinases (CDKs), whose activities are regulated by cyclins and CDK inhibitors in a diverse array of mechanisms that involve the control of phosphorylation and dephosphorylation of Ser, Thr or Tyr residues. Cyclins are molecules that possess a consensus domain called the 'cyclin box.' In mammalian cells, 9 cyclin species have been identified, and they are referred to as cyclins A through I. Cyclin G is a direct transcriptional target of the p53 tumor suppressor gene product and thus functions downstream of p53. GAK is an association partner of cyclin G and CDK5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a deletion of the kinase domain display neonatal lethality with abnormal lung alveolar morphology and development. Mice homozygous for a knock-out allele exhibit lethality during early development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G T 10: 82,295,316 T620K probably benign Het
4932438A13Rik T C 3: 37,008,443 I3368T probably damaging Het
Adamtsl5 A G 10: 80,341,913 V305A possibly damaging Het
Adgrl4 A G 3: 151,492,375 T91A probably benign Het
Ano6 A G 15: 95,967,714 I860V probably benign Het
B3galnt1 A G 3: 69,575,533 S132P probably damaging Het
Btbd10 A T 7: 113,347,059 V33E probably benign Het
Cacna1g A T 11: 94,439,722 V989D probably damaging Het
Celsr3 A G 9: 108,835,790 D1807G probably benign Het
Chd6 A G 2: 161,013,067 M807T probably damaging Het
Cpxm2 T C 7: 132,070,860 D320G probably damaging Het
Cryzl1 A C 16: 91,692,525 probably null Het
Dcbld2 A T 16: 58,433,373 K158* probably null Het
Depdc5 A G 5: 32,912,231 N437S probably benign Het
Dock7 G A 4: 98,967,227 S1496L probably benign Het
Eea1 T G 10: 96,028,412 I931R probably benign Het
Eif2ak4 C A 2: 118,436,241 L714I probably damaging Het
Enpep A G 3: 129,331,860 probably null Het
Fam83b T A 9: 76,502,131 K238* probably null Het
Fam83f A G 15: 80,692,111 Y321C possibly damaging Het
Fanci A G 7: 79,417,939 I42V probably benign Het
Flg2 A T 3: 93,214,421 R1299S unknown Het
Gcnt7 A G 2: 172,454,073 L277P probably damaging Het
Gucy2d A G 7: 98,449,961 E329G probably benign Het
Hacd1 T C 2: 14,035,944 I167V probably damaging Het
Hdlbp T A 1: 93,417,667 D662V possibly damaging Het
Hspa4 A T 11: 53,265,056 V674E probably benign Het
Hunk A G 16: 90,493,432 Q442R possibly damaging Het
Lce1j A T 3: 92,789,422 C16* probably null Het
Lrat A T 3: 82,903,492 M74K probably damaging Het
Lrig2 G A 3: 104,467,193 R191C probably damaging Het
Lrrc37a A C 11: 103,460,840 F2558L unknown Het
Mctp1 T A 13: 76,731,811 probably null Het
Mecom T A 3: 30,140,386 probably benign Het
Mgst1 A G 6: 138,141,587 probably null Het
Ms4a15 T G 19: 10,993,170 E3A probably benign Het
Myo1d T C 11: 80,557,474 I942V probably benign Het
Neu2 A G 1: 87,596,878 Y195C probably damaging Het
Nipa1 A T 7: 56,019,504 V22E probably benign Het
Olfr1061 T A 2: 86,414,037 N5I probably damaging Het
Olfr733 A T 14: 50,298,467 L281I probably benign Het
Olfr781 T C 10: 129,333,711 S277P possibly damaging Het
Pik3r4 A G 9: 105,685,190 T1223A possibly damaging Het
Ppl T C 16: 5,092,441 D811G probably damaging Het
Prep T A 10: 45,115,107 Y290N probably damaging Het
Ptk6 A T 2: 181,199,102 H215Q probably benign Het
Rad50 A G 11: 53,692,144 I474T possibly damaging Het
Rnf213 T A 11: 119,452,687 V3626E possibly damaging Het
Scn4a C T 11: 106,345,676 V253M probably damaging Het
Snta1 T A 2: 154,377,149 D422V probably damaging Het
Stk38 A G 17: 28,984,112 L160P probably benign Het
Tapbp T C 17: 33,926,098 F323S probably damaging Het
Uggt1 C T 1: 36,173,450 R937Q probably benign Het
Vash2 G A 1: 190,978,287 P57L probably damaging Het
Vmn1r4 G A 6: 56,956,867 V119I probably benign Het
Vmn2r74 T C 7: 85,961,391 D31G probably benign Het
Zfp114 T C 7: 24,177,781 V16A possibly damaging Het
Other mutations in Gak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Gak APN 5 108613634 makesense probably null
IGL00768:Gak APN 5 108576654 missense probably benign
IGL01128:Gak APN 5 108592370 missense probably damaging 0.97
IGL01557:Gak APN 5 108584337 missense probably damaging 1.00
IGL02559:Gak APN 5 108584232 missense probably null 0.07
PIT4449001:Gak UTSW 5 108580925 missense probably benign 0.00
R0030:Gak UTSW 5 108613547 nonsense probably null
R1403:Gak UTSW 5 108591145 missense probably damaging 1.00
R1403:Gak UTSW 5 108591145 missense probably damaging 1.00
R1530:Gak UTSW 5 108624193 missense probably damaging 0.97
R1646:Gak UTSW 5 108602854 missense probably damaging 1.00
R1699:Gak UTSW 5 108604377 nonsense probably null
R1702:Gak UTSW 5 108606376 splice site probably null
R1732:Gak UTSW 5 108576582 missense probably benign 0.28
R1738:Gak UTSW 5 108616976 missense probably damaging 1.00
R1772:Gak UTSW 5 108606892 missense probably damaging 1.00
R1792:Gak UTSW 5 108585531 nonsense probably null
R2068:Gak UTSW 5 108570225 missense probably benign
R2137:Gak UTSW 5 108606877 splice site probably null
R2138:Gak UTSW 5 108606877 splice site probably null
R2139:Gak UTSW 5 108606877 splice site probably null
R2904:Gak UTSW 5 108624214 missense possibly damaging 0.70
R3080:Gak UTSW 5 108613602 missense possibly damaging 0.90
R3773:Gak UTSW 5 108582672 missense probably benign 0.00
R4523:Gak UTSW 5 108576566 missense probably benign 0.22
R4665:Gak UTSW 5 108582960 missense probably benign
R4703:Gak UTSW 5 108569877 missense probably damaging 0.99
R4890:Gak UTSW 5 108580876 unclassified probably benign
R4951:Gak UTSW 5 108582718 missense probably benign
R4971:Gak UTSW 5 108596806 missense probably damaging 1.00
R5328:Gak UTSW 5 108617001 missense possibly damaging 0.94
R5436:Gak UTSW 5 108592352 missense possibly damaging 0.94
R5496:Gak UTSW 5 108576617 missense probably benign 0.00
R6207:Gak UTSW 5 108625029 critical splice donor site probably null
R6359:Gak UTSW 5 108571900 missense probably damaging 1.00
R6682:Gak UTSW 5 108598876 missense probably damaging 1.00
R6915:Gak UTSW 5 108602950 missense probably benign 0.20
R7403:Gak UTSW 5 108613535 missense probably benign 0.00
R7458:Gak UTSW 5 108583074 missense probably benign 0.00
R7522:Gak UTSW 5 108591199 missense possibly damaging 0.95
R7650:Gak UTSW 5 108584295 missense probably benign 0.00
R7737:Gak UTSW 5 108617008 missense probably benign 0.15
R8437:Gak UTSW 5 108609406 missense probably benign 0.30
R8739:Gak UTSW 5 108591738 missense possibly damaging 0.65
X0064:Gak UTSW 5 108613533 nonsense probably null
Z1177:Gak UTSW 5 108585352 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAGCTGGCTGGCTCTTTCAG -3'
(R):5'- AGAGGGCTTCTGTCTCTGTC -3'

Sequencing Primer
(F):5'- TCTTTCAGGCAAGAGCAATGC -3'
(R):5'- ACTCATATCTAGCATTTCCACTAGG -3'
Posted On2018-05-21