Incidental Mutation 'R6468:Cpxm2'
ID 516429
Institutional Source Beutler Lab
Gene Symbol Cpxm2
Ensembl Gene ENSMUSG00000030862
Gene Name carboxypeptidase X 2 (M14 family)
Synonyms 4632435C11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R6468 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 132032687-132154739 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 132070860 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 320 (D320G)
Ref Sequence ENSEMBL: ENSMUSP00000033149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033149] [ENSMUST00000124096]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033149
AA Change: D320G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033149
Gene: ENSMUSG00000030862
AA Change: D320G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 52 59 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
FA58C 143 301 2.18e-46 SMART
Zn_pept 448 736 9.21e-58 SMART
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127039
Meta Mutation Damage Score 0.6171 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G T 10: 82,295,316 T620K probably benign Het
4932438A13Rik T C 3: 37,008,443 I3368T probably damaging Het
Adamtsl5 A G 10: 80,341,913 V305A possibly damaging Het
Adgrl4 A G 3: 151,492,375 T91A probably benign Het
Ano6 A G 15: 95,967,714 I860V probably benign Het
B3galnt1 A G 3: 69,575,533 S132P probably damaging Het
Btbd10 A T 7: 113,347,059 V33E probably benign Het
Cacna1g A T 11: 94,439,722 V989D probably damaging Het
Celsr3 A G 9: 108,835,790 D1807G probably benign Het
Chd6 A G 2: 161,013,067 M807T probably damaging Het
Cryzl1 A C 16: 91,692,525 probably null Het
Dcbld2 A T 16: 58,433,373 K158* probably null Het
Depdc5 A G 5: 32,912,231 N437S probably benign Het
Dock7 G A 4: 98,967,227 S1496L probably benign Het
Eea1 T G 10: 96,028,412 I931R probably benign Het
Eif2ak4 C A 2: 118,436,241 L714I probably damaging Het
Enpep A G 3: 129,331,860 probably null Het
Fam83b T A 9: 76,502,131 K238* probably null Het
Fam83f A G 15: 80,692,111 Y321C possibly damaging Het
Fanci A G 7: 79,417,939 I42V probably benign Het
Flg2 A T 3: 93,214,421 R1299S unknown Het
Gak G T 5: 108,623,336 C102* probably null Het
Gcnt7 A G 2: 172,454,073 L277P probably damaging Het
Gucy2d A G 7: 98,449,961 E329G probably benign Het
Hacd1 T C 2: 14,035,944 I167V probably damaging Het
Hdlbp T A 1: 93,417,667 D662V possibly damaging Het
Hspa4 A T 11: 53,265,056 V674E probably benign Het
Hunk A G 16: 90,493,432 Q442R possibly damaging Het
Lce1j A T 3: 92,789,422 C16* probably null Het
Lrat A T 3: 82,903,492 M74K probably damaging Het
Lrig2 G A 3: 104,467,193 R191C probably damaging Het
Lrrc37a A C 11: 103,460,840 F2558L unknown Het
Mctp1 T A 13: 76,731,811 probably null Het
Mecom T A 3: 30,140,386 probably benign Het
Mgst1 A G 6: 138,141,587 probably null Het
Ms4a15 T G 19: 10,993,170 E3A probably benign Het
Myo1d T C 11: 80,557,474 I942V probably benign Het
Neu2 A G 1: 87,596,878 Y195C probably damaging Het
Nipa1 A T 7: 56,019,504 V22E probably benign Het
Olfr1061 T A 2: 86,414,037 N5I probably damaging Het
Olfr733 A T 14: 50,298,467 L281I probably benign Het
Olfr781 T C 10: 129,333,711 S277P possibly damaging Het
Pik3r4 A G 9: 105,685,190 T1223A possibly damaging Het
Ppl T C 16: 5,092,441 D811G probably damaging Het
Prep T A 10: 45,115,107 Y290N probably damaging Het
Ptk6 A T 2: 181,199,102 H215Q probably benign Het
Rad50 A G 11: 53,692,144 I474T possibly damaging Het
Rnf213 T A 11: 119,452,687 V3626E possibly damaging Het
Scn4a C T 11: 106,345,676 V253M probably damaging Het
Snta1 T A 2: 154,377,149 D422V probably damaging Het
Stk38 A G 17: 28,984,112 L160P probably benign Het
Tapbp T C 17: 33,926,098 F323S probably damaging Het
Uggt1 C T 1: 36,173,450 R937Q probably benign Het
Vash2 G A 1: 190,978,287 P57L probably damaging Het
Vmn1r4 G A 6: 56,956,867 V119I probably benign Het
Vmn2r74 T C 7: 85,961,391 D31G probably benign Het
Zfp114 T C 7: 24,177,781 V16A possibly damaging Het
Other mutations in Cpxm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Cpxm2 APN 7 132059811 missense probably benign 0.01
IGL02039:Cpxm2 APN 7 132047753 missense probably damaging 1.00
IGL03011:Cpxm2 APN 7 132049078 missense possibly damaging 0.46
R0033:Cpxm2 UTSW 7 132062157 missense possibly damaging 0.55
R0100:Cpxm2 UTSW 7 132054871 missense possibly damaging 0.90
R0100:Cpxm2 UTSW 7 132054871 missense possibly damaging 0.90
R0453:Cpxm2 UTSW 7 132128405 missense probably damaging 1.00
R0555:Cpxm2 UTSW 7 132044043 nonsense probably null
R0655:Cpxm2 UTSW 7 132054820 missense possibly damaging 0.87
R0834:Cpxm2 UTSW 7 132154613 intron probably benign
R1145:Cpxm2 UTSW 7 132057648 missense probably damaging 0.99
R1145:Cpxm2 UTSW 7 132057648 missense probably damaging 0.99
R1249:Cpxm2 UTSW 7 132128350 critical splice donor site probably null
R1563:Cpxm2 UTSW 7 132143682 missense probably benign 0.00
R1565:Cpxm2 UTSW 7 132062145 missense probably damaging 1.00
R1709:Cpxm2 UTSW 7 132059834 missense probably damaging 1.00
R1863:Cpxm2 UTSW 7 132143663 splice site probably null
R1874:Cpxm2 UTSW 7 132059834 missense probably damaging 1.00
R1958:Cpxm2 UTSW 7 132062147 missense probably damaging 1.00
R2273:Cpxm2 UTSW 7 132059852 intron probably benign
R3806:Cpxm2 UTSW 7 132080091 missense probably benign 0.12
R3861:Cpxm2 UTSW 7 132054919 missense probably benign 0.00
R4570:Cpxm2 UTSW 7 132143706 missense probably benign 0.11
R4642:Cpxm2 UTSW 7 132070881 missense probably benign 0.11
R4684:Cpxm2 UTSW 7 132049038 missense possibly damaging 0.92
R4717:Cpxm2 UTSW 7 132054845 missense possibly damaging 0.61
R4863:Cpxm2 UTSW 7 132059747 missense probably benign 0.13
R5079:Cpxm2 UTSW 7 132154285 critical splice donor site probably null
R5341:Cpxm2 UTSW 7 132154613 intron probably benign
R5626:Cpxm2 UTSW 7 132059852 intron probably benign
R5666:Cpxm2 UTSW 7 132054896 missense probably benign 0.44
R5815:Cpxm2 UTSW 7 132044110 missense probably damaging 1.00
R6114:Cpxm2 UTSW 7 132154306 missense probably benign
R6133:Cpxm2 UTSW 7 132128453 missense probably damaging 1.00
R6224:Cpxm2 UTSW 7 132143731 missense probably benign
R6657:Cpxm2 UTSW 7 132049077 missense probably damaging 1.00
R7058:Cpxm2 UTSW 7 132143679 missense probably benign 0.32
R7100:Cpxm2 UTSW 7 132054815 missense probably benign 0.06
R7198:Cpxm2 UTSW 7 132080084 missense probably damaging 1.00
R7712:Cpxm2 UTSW 7 132154378 missense possibly damaging 0.69
R7855:Cpxm2 UTSW 7 132057695 missense possibly damaging 0.56
R7867:Cpxm2 UTSW 7 132049071 missense probably damaging 1.00
R8513:Cpxm2 UTSW 7 132143702 missense probably benign 0.01
R8694:Cpxm2 UTSW 7 132080054 missense probably benign 0.03
R8874:Cpxm2 UTSW 7 132106281 critical splice donor site probably null
R8967:Cpxm2 UTSW 7 132059835 missense probably damaging 1.00
RF014:Cpxm2 UTSW 7 132070863 missense possibly damaging 0.85
Z1177:Cpxm2 UTSW 7 132055001 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGACACACAAAAGCTTTAGGG -3'
(R):5'- TGCCTCTGAGCCAAATGTTAG -3'

Sequencing Primer
(F):5'- TAGGGACTAAAGACTTCAATGCC -3'
(R):5'- GCCTCTGAGCCAAATGTTAGAAGTTC -3'
Posted On 2018-05-21