Incidental Mutation 'R6468:Fam83b'
ID 516430
Institutional Source Beutler Lab
Gene Symbol Fam83b
Ensembl Gene ENSMUSG00000032358
Gene Name family with sequence similarity 83, member B
Synonyms C530008M07Rik
MMRRC Submission 044601-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R6468 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 76397336-76474398 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 76409413 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 238 (K238*)
Ref Sequence ENSEMBL: ENSMUSP00000139354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098546] [ENSMUST00000183437]
AlphaFold Q0VBM2
Predicted Effect probably null
Transcript: ENSMUST00000098546
AA Change: K238*
SMART Domains Protein: ENSMUSP00000096146
Gene: ENSMUSG00000032358
AA Change: K238*

DomainStartEndE-ValueType
Pfam:DUF1669 12 282 5.6e-109 PFAM
Pfam:PLDc_2 139 277 2.4e-12 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183437
AA Change: K238*
SMART Domains Protein: ENSMUSP00000139354
Gene: ENSMUSG00000032358
AA Change: K238*

DomainStartEndE-ValueType
Pfam:DUF1669 7 283 2.8e-111 PFAM
Pfam:PLDc_2 139 277 2.4e-9 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,177,747 (GRCm39) V305A possibly damaging Het
Adgrl4 A G 3: 151,198,012 (GRCm39) T91A probably benign Het
Ano6 A G 15: 95,865,595 (GRCm39) I860V probably benign Het
B3galnt1 A G 3: 69,482,866 (GRCm39) S132P probably damaging Het
Bltp1 T C 3: 37,062,592 (GRCm39) I3368T probably damaging Het
Btbd10 A T 7: 112,946,266 (GRCm39) V33E probably benign Het
Cacna1g A T 11: 94,330,548 (GRCm39) V989D probably damaging Het
Celsr3 A G 9: 108,712,989 (GRCm39) D1807G probably benign Het
Chd6 A G 2: 160,854,987 (GRCm39) M807T probably damaging Het
Cpxm2 T C 7: 131,672,589 (GRCm39) D320G probably damaging Het
Cryzl1 A C 16: 91,489,413 (GRCm39) probably null Het
Dcbld2 A T 16: 58,253,736 (GRCm39) K158* probably null Het
Depdc5 A G 5: 33,069,575 (GRCm39) N437S probably benign Het
Dock7 G A 4: 98,855,464 (GRCm39) S1496L probably benign Het
Eea1 T G 10: 95,864,274 (GRCm39) I931R probably benign Het
Eif2ak4 C A 2: 118,266,722 (GRCm39) L714I probably damaging Het
Enpep A G 3: 129,125,509 (GRCm39) probably null Het
Fam83f A G 15: 80,576,312 (GRCm39) Y321C possibly damaging Het
Fanci A G 7: 79,067,687 (GRCm39) I42V probably benign Het
Flg2 A T 3: 93,121,728 (GRCm39) R1299S unknown Het
Gak G T 5: 108,771,202 (GRCm39) C102* probably null Het
Gcnt7 A G 2: 172,295,993 (GRCm39) L277P probably damaging Het
Gucy2d A G 7: 98,099,168 (GRCm39) E329G probably benign Het
Hacd1 T C 2: 14,040,755 (GRCm39) I167V probably damaging Het
Hdlbp T A 1: 93,345,389 (GRCm39) D662V possibly damaging Het
Hspa4 A T 11: 53,155,883 (GRCm39) V674E probably benign Het
Hunk A G 16: 90,290,320 (GRCm39) Q442R possibly damaging Het
Lce1j A T 3: 92,696,729 (GRCm39) C16* probably null Het
Lrat A T 3: 82,810,799 (GRCm39) M74K probably damaging Het
Lrig2 G A 3: 104,374,509 (GRCm39) R191C probably damaging Het
Lrrc37a A C 11: 103,351,666 (GRCm39) F2558L unknown Het
Mctp1 T A 13: 76,879,930 (GRCm39) probably null Het
Mecom T A 3: 30,194,535 (GRCm39) probably benign Het
Mgst1 A G 6: 138,118,585 (GRCm39) probably null Het
Ms4a15 T G 19: 10,970,534 (GRCm39) E3A probably benign Het
Myo1d T C 11: 80,448,300 (GRCm39) I942V probably benign Het
Neu2 A G 1: 87,524,600 (GRCm39) Y195C probably damaging Het
Nipa1 A T 7: 55,669,252 (GRCm39) V22E probably benign Het
Or4n4b A T 14: 50,535,924 (GRCm39) L281I probably benign Het
Or6c35 T C 10: 129,169,580 (GRCm39) S277P possibly damaging Het
Or8k25 T A 2: 86,244,381 (GRCm39) N5I probably damaging Het
Pik3r4 A G 9: 105,562,389 (GRCm39) T1223A possibly damaging Het
Ppl T C 16: 4,910,305 (GRCm39) D811G probably damaging Het
Prep T A 10: 44,991,203 (GRCm39) Y290N probably damaging Het
Ptk6 A T 2: 180,840,895 (GRCm39) H215Q probably benign Het
Rad50 A G 11: 53,582,971 (GRCm39) I474T possibly damaging Het
Rnf213 T A 11: 119,343,513 (GRCm39) V3626E possibly damaging Het
Scn4a C T 11: 106,236,502 (GRCm39) V253M probably damaging Het
Snta1 T A 2: 154,219,069 (GRCm39) D422V probably damaging Het
Spata31h1 G T 10: 82,131,150 (GRCm39) T620K probably benign Het
Stk38 A G 17: 29,203,086 (GRCm39) L160P probably benign Het
Tapbp T C 17: 34,145,072 (GRCm39) F323S probably damaging Het
Uggt1 C T 1: 36,212,531 (GRCm39) R937Q probably benign Het
Vash2 G A 1: 190,710,484 (GRCm39) P57L probably damaging Het
Vmn1r4 G A 6: 56,933,852 (GRCm39) V119I probably benign Het
Vmn2r74 T C 7: 85,610,599 (GRCm39) D31G probably benign Het
Zfp114 T C 7: 23,877,206 (GRCm39) V16A possibly damaging Het
Other mutations in Fam83b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fam83b APN 9 76,398,260 (GRCm39) missense probably benign 0.00
IGL01554:Fam83b APN 9 76,409,403 (GRCm39) missense probably benign 0.33
IGL01694:Fam83b APN 9 76,398,272 (GRCm39) missense probably benign 0.13
IGL02009:Fam83b APN 9 76,399,604 (GRCm39) missense probably damaging 1.00
IGL02531:Fam83b APN 9 76,399,282 (GRCm39) missense possibly damaging 0.61
IGL03328:Fam83b APN 9 76,400,324 (GRCm39) missense probably benign 0.01
PIT4581001:Fam83b UTSW 9 76,398,434 (GRCm39) missense probably damaging 1.00
R0110:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0469:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0510:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0732:Fam83b UTSW 9 76,400,210 (GRCm39) nonsense probably null
R0946:Fam83b UTSW 9 76,398,679 (GRCm39) missense probably damaging 0.96
R0961:Fam83b UTSW 9 76,398,577 (GRCm39) missense probably damaging 0.97
R1101:Fam83b UTSW 9 76,452,952 (GRCm39) missense possibly damaging 0.68
R1200:Fam83b UTSW 9 76,399,594 (GRCm39) missense probably damaging 1.00
R1248:Fam83b UTSW 9 76,410,358 (GRCm39) missense probably benign 0.35
R1420:Fam83b UTSW 9 76,399,894 (GRCm39) missense possibly damaging 0.94
R1429:Fam83b UTSW 9 76,399,859 (GRCm39) missense probably benign
R1939:Fam83b UTSW 9 76,400,362 (GRCm39) missense probably damaging 1.00
R1992:Fam83b UTSW 9 76,399,304 (GRCm39) missense probably benign
R2102:Fam83b UTSW 9 76,399,987 (GRCm39) missense probably damaging 0.96
R2134:Fam83b UTSW 9 76,398,298 (GRCm39) missense probably damaging 1.00
R2398:Fam83b UTSW 9 76,409,500 (GRCm39) missense probably damaging 1.00
R2878:Fam83b UTSW 9 76,398,092 (GRCm39) missense probably damaging 1.00
R4092:Fam83b UTSW 9 76,398,943 (GRCm39) missense probably benign 0.24
R4204:Fam83b UTSW 9 76,410,335 (GRCm39) missense probably benign 0.09
R4537:Fam83b UTSW 9 76,399,424 (GRCm39) missense probably benign 0.10
R4920:Fam83b UTSW 9 76,399,150 (GRCm39) missense probably benign
R5456:Fam83b UTSW 9 76,399,877 (GRCm39) missense probably benign
R5473:Fam83b UTSW 9 76,398,782 (GRCm39) missense probably damaging 1.00
R5488:Fam83b UTSW 9 76,452,881 (GRCm39) missense probably benign 0.05
R5489:Fam83b UTSW 9 76,452,881 (GRCm39) missense probably benign 0.05
R5876:Fam83b UTSW 9 76,399,132 (GRCm39) missense possibly damaging 0.92
R6150:Fam83b UTSW 9 76,399,639 (GRCm39) missense probably damaging 1.00
R6374:Fam83b UTSW 9 76,400,189 (GRCm39) missense probably benign 0.31
R6912:Fam83b UTSW 9 76,398,214 (GRCm39) missense probably damaging 0.99
R7022:Fam83b UTSW 9 76,409,394 (GRCm39) frame shift probably null
R7073:Fam83b UTSW 9 76,453,031 (GRCm39) missense probably benign 0.18
R7356:Fam83b UTSW 9 76,400,135 (GRCm39) missense probably benign 0.05
R7665:Fam83b UTSW 9 76,398,157 (GRCm39) missense probably damaging 1.00
R7762:Fam83b UTSW 9 76,399,714 (GRCm39) missense possibly damaging 0.87
R7790:Fam83b UTSW 9 76,399,330 (GRCm39) missense probably benign 0.01
R7869:Fam83b UTSW 9 76,399,426 (GRCm39) missense possibly damaging 0.78
R7879:Fam83b UTSW 9 76,399,737 (GRCm39) missense possibly damaging 0.76
R7957:Fam83b UTSW 9 76,399,267 (GRCm39) missense probably benign 0.00
R8067:Fam83b UTSW 9 76,398,380 (GRCm39) missense probably benign
R8983:Fam83b UTSW 9 76,400,357 (GRCm39) missense probably damaging 1.00
R9361:Fam83b UTSW 9 76,400,076 (GRCm39) missense probably benign 0.03
R9405:Fam83b UTSW 9 76,398,703 (GRCm39) missense possibly damaging 0.93
R9475:Fam83b UTSW 9 76,399,085 (GRCm39) missense probably benign 0.31
R9656:Fam83b UTSW 9 76,452,863 (GRCm39) missense probably benign 0.02
R9690:Fam83b UTSW 9 76,398,502 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACAGAGATGTTTGCAAGGT -3'
(R):5'- AAATAAGTAGTTTTGGGTGGTTTACG -3'

Sequencing Primer
(F):5'- TGAGTGCTTCGAACCAATCTCAGG -3'
(R):5'- CATTCGCATACGGACAGTA -3'
Posted On 2018-05-21