Mutagenetix > Incidental Mutation

Incidental Mutation 'R6468:Myo1d'

516440

Institutional Source

Beutler Lab

Gene Symbol

Myo1d

Ensembl Gene

ENSMUSG00000035441

Gene Name

myosin ID

Synonyms

9930104H07Rik, D11Ertd9e

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6468 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80482126-80780025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80557474 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 942 (I942V)

Ref Sequence

ENSEMBL: ENSMUSP00000037819 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041065]

AlphaFold

Q5SYD0

Predicted Effect

probably benign
Transcript: ENSMUST00000041065
AA Change: I942V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: I942V

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

97% (57/59)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	G	T	10: 82,295,316	T620K	probably benign	Het
4932438A13Rik	T	C	3: 37,008,443	I3368T	probably damaging	Het
Adamtsl5	A	G	10: 80,341,913	V305A	possibly damaging	Het
Adgrl4	A	G	3: 151,492,375	T91A	probably benign	Het
Ano6	A	G	15: 95,967,714	I860V	probably benign	Het
B3galnt1	A	G	3: 69,575,533	S132P	probably damaging	Het
Btbd10	A	T	7: 113,347,059	V33E	probably benign	Het
Cacna1g	A	T	11: 94,439,722	V989D	probably damaging	Het
Celsr3	A	G	9: 108,835,790	D1807G	probably benign	Het
Chd6	A	G	2: 161,013,067	M807T	probably damaging	Het
Cpxm2	T	C	7: 132,070,860	D320G	probably damaging	Het
Cryzl1	A	C	16: 91,692,525		probably null	Het
Dcbld2	A	T	16: 58,433,373	K158*	probably null	Het
Depdc5	A	G	5: 32,912,231	N437S	probably benign	Het
Dock7	G	A	4: 98,967,227	S1496L	probably benign	Het
Eea1	T	G	10: 96,028,412	I931R	probably benign	Het
Eif2ak4	C	A	2: 118,436,241	L714I	probably damaging	Het
Enpep	A	G	3: 129,331,860		probably null	Het
Fam83b	T	A	9: 76,502,131	K238*	probably null	Het
Fam83f	A	G	15: 80,692,111	Y321C	possibly damaging	Het
Fanci	A	G	7: 79,417,939	I42V	probably benign	Het
Flg2	A	T	3: 93,214,421	R1299S	unknown	Het
Gak	G	T	5: 108,623,336	C102*	probably null	Het
Gcnt7	A	G	2: 172,454,073	L277P	probably damaging	Het
Gucy2d	A	G	7: 98,449,961	E329G	probably benign	Het
Hacd1	T	C	2: 14,035,944	I167V	probably damaging	Het
Hdlbp	T	A	1: 93,417,667	D662V	possibly damaging	Het
Hspa4	A	T	11: 53,265,056	V674E	probably benign	Het
Hunk	A	G	16: 90,493,432	Q442R	possibly damaging	Het
Lce1j	A	T	3: 92,789,422	C16*	probably null	Het
Lrat	A	T	3: 82,903,492	M74K	probably damaging	Het
Lrig2	G	A	3: 104,467,193	R191C	probably damaging	Het
Lrrc37a	A	C	11: 103,460,840	F2558L	unknown	Het
Mctp1	T	A	13: 76,731,811		probably null	Het
Mecom	T	A	3: 30,140,386		probably benign	Het
Mgst1	A	G	6: 138,141,587		probably null	Het
Ms4a15	T	G	19: 10,993,170	E3A	probably benign	Het
Neu2	A	G	1: 87,596,878	Y195C	probably damaging	Het
Nipa1	A	T	7: 56,019,504	V22E	probably benign	Het
Olfr1061	T	A	2: 86,414,037	N5I	probably damaging	Het
Olfr733	A	T	14: 50,298,467	L281I	probably benign	Het
Olfr781	T	C	10: 129,333,711	S277P	possibly damaging	Het
Pik3r4	A	G	9: 105,685,190	T1223A	possibly damaging	Het
Ppl	T	C	16: 5,092,441	D811G	probably damaging	Het
Prep	T	A	10: 45,115,107	Y290N	probably damaging	Het
Ptk6	A	T	2: 181,199,102	H215Q	probably benign	Het
Rad50	A	G	11: 53,692,144	I474T	possibly damaging	Het
Rnf213	T	A	11: 119,452,687	V3626E	possibly damaging	Het
Scn4a	C	T	11: 106,345,676	V253M	probably damaging	Het
Snta1	T	A	2: 154,377,149	D422V	probably damaging	Het
Stk38	A	G	17: 28,984,112	L160P	probably benign	Het
Tapbp	T	C	17: 33,926,098	F323S	probably damaging	Het
Uggt1	C	T	1: 36,173,450	R937Q	probably benign	Het
Vash2	G	A	1: 190,978,287	P57L	probably damaging	Het
Vmn1r4	G	A	6: 56,956,867	V119I	probably benign	Het
Vmn2r74	T	C	7: 85,961,391	D31G	probably benign	Het
Zfp114	T	C	7: 24,177,781	V16A	possibly damaging	Het

Other mutations in Myo1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Myo1d	APN	11	80601740	missense	probably benign
IGL01087:Myo1d	APN	11	80682435	missense	probably damaging	1.00
IGL01326:Myo1d	APN	11	80684321	splice site	probably benign
IGL01431:Myo1d	APN	11	80674839	missense	probably damaging	1.00
IGL01595:Myo1d	APN	11	80676110	missense	probably benign	0.00
IGL01811:Myo1d	APN	11	80692997	missense	probably damaging	0.96
IGL02301:Myo1d	APN	11	80676853	missense	probably benign	0.23
IGL02388:Myo1d	APN	11	80637997	nonsense	probably null
IGL02485:Myo1d	APN	11	80666581	missense	probably damaging	1.00
IGL03017:Myo1d	APN	11	80601626	missense	probably benign	0.26
horton	UTSW	11	80674708	missense	probably damaging	1.00
multifaceted	UTSW	11	80693072	missense	probably damaging	1.00
whisper	UTSW	11	80484332	missense	probably damaging	0.99
whisper2	UTSW	11	80666578	missense	probably damaging	1.00
whisper3	UTSW	11	80557521	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0081:Myo1d	UTSW	11	80557523	missense	probably benign	0.00
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0244:Myo1d	UTSW	11	80674708	missense	probably damaging	1.00
R0711:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0746:Myo1d	UTSW	11	80586879	missense	possibly damaging	0.94
R1084:Myo1d	UTSW	11	80684395	missense	probably damaging	1.00
R1514:Myo1d	UTSW	11	80685908	missense	probably damaging	0.97
R1676:Myo1d	UTSW	11	80684421	missense	probably damaging	1.00
R1862:Myo1d	UTSW	11	80663048	missense	probably damaging	1.00
R2497:Myo1d	UTSW	11	80674821	missense	probably damaging	1.00
R2512:Myo1d	UTSW	11	80779717	missense	probably benign	0.00
R3425:Myo1d	UTSW	11	80601638	missense	probably benign
R3429:Myo1d	UTSW	11	80682410	missense	probably damaging	1.00
R3917:Myo1d	UTSW	11	80666578	missense	probably damaging	1.00
R3928:Myo1d	UTSW	11	80484261	missense	probably benign	0.09
R4706:Myo1d	UTSW	11	80666641	missense	probably damaging	0.96
R4723:Myo1d	UTSW	11	80779841	utr 5 prime	probably benign
R4924:Myo1d	UTSW	11	80674678	missense	probably damaging	1.00
R5042:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R5320:Myo1d	UTSW	11	80684323	critical splice donor site	probably null
R5481:Myo1d	UTSW	11	80663095	missense	possibly damaging	0.79
R6214:Myo1d	UTSW	11	80779791	start codon destroyed	probably null	0.98
R6235:Myo1d	UTSW	11	80692944	missense	probably benign	0.23
R6282:Myo1d	UTSW	11	80557512	missense	probably damaging	0.99
R6668:Myo1d	UTSW	11	80583875	intron	probably benign
R6954:Myo1d	UTSW	11	80674957	missense	probably benign	0.21
R7077:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7078:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7080:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7172:Myo1d	UTSW	11	80592795	missense	probably benign	0.16
R7276:Myo1d	UTSW	11	80693072	missense	probably damaging	1.00
R7467:Myo1d	UTSW	11	80586917	missense	probably damaging	1.00
R7650:Myo1d	UTSW	11	80601684	missense	probably benign
R7678:Myo1d	UTSW	11	80676893	missense	possibly damaging	0.80
R7859:Myo1d	UTSW	11	80684377	missense	probably damaging	1.00
R8324:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R8329:Myo1d	UTSW	11	80638074	missense	probably benign	0.21
R8474:Myo1d	UTSW	11	80670919	missense	possibly damaging	0.93
R8799:Myo1d	UTSW	11	80684379	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80674932	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80676932	missense	probably benign	0.30
R8823:Myo1d	UTSW	11	80601745	missense	possibly damaging	0.91
R9221:Myo1d	UTSW	11	80674918	missense	probably damaging	1.00
R9494:Myo1d	UTSW	11	80484267	missense	probably benign	0.02
R9625:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9626:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9628:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
Z1088:Myo1d	UTSW	11	80674898	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AATAAGGCCGGATGCTAATTTCAC -3'
(R):5'- ACCATCGTTGCTATGGCCTG -3'

Sequencing Primer
(F):5'- GCCGGATGCTAATTTCACCTTCTATG -3'
(R):5'- TGCTCTAATTCATTCTTCCAGGAG -3'

Posted On

2018-05-21