Incidental Mutation 'R6468:Olfr733'
ID516446
Institutional Source Beutler Lab
Gene Symbol Olfr733
Ensembl Gene ENSMUSG00000090874
Gene Nameolfactory receptor 733
SynonymsMOR241-2, GA_x6K02T2PMLR-5992342-5991416
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R6468 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50295891-50301522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50298467 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 281 (L281I)
Ref Sequence ENSEMBL: ENSMUSP00000149807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163469] [ENSMUST00000214372] [ENSMUST00000214756] [ENSMUST00000216195]
Predicted Effect probably benign
Transcript: ENSMUST00000163469
AA Change: L281I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128332
Gene: ENSMUSG00000090874
AA Change: L281I

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 6.4e-41 PFAM
Pfam:7tm_1 41 288 1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214372
AA Change: L281I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000214756
AA Change: L281I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000216195
AA Change: L281I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G T 10: 82,295,316 T620K probably benign Het
4932438A13Rik T C 3: 37,008,443 I3368T probably damaging Het
Adamtsl5 A G 10: 80,341,913 V305A possibly damaging Het
Adgrl4 A G 3: 151,492,375 T91A probably benign Het
Ano6 A G 15: 95,967,714 I860V probably benign Het
B3galnt1 A G 3: 69,575,533 S132P probably damaging Het
Btbd10 A T 7: 113,347,059 V33E probably benign Het
Cacna1g A T 11: 94,439,722 V989D probably damaging Het
Celsr3 A G 9: 108,835,790 D1807G probably benign Het
Chd6 A G 2: 161,013,067 M807T probably damaging Het
Cpxm2 T C 7: 132,070,860 D320G probably damaging Het
Cryzl1 A C 16: 91,692,525 probably null Het
Dcbld2 A T 16: 58,433,373 K158* probably null Het
Depdc5 A G 5: 32,912,231 N437S probably benign Het
Dock7 G A 4: 98,967,227 S1496L probably benign Het
Eea1 T G 10: 96,028,412 I931R probably benign Het
Eif2ak4 C A 2: 118,436,241 L714I probably damaging Het
Enpep A G 3: 129,331,860 probably null Het
Fam83b T A 9: 76,502,131 K238* probably null Het
Fam83f A G 15: 80,692,111 Y321C possibly damaging Het
Fanci A G 7: 79,417,939 I42V probably benign Het
Flg2 A T 3: 93,214,421 R1299S unknown Het
Gak G T 5: 108,623,336 C102* probably null Het
Gcnt7 A G 2: 172,454,073 L277P probably damaging Het
Gucy2d A G 7: 98,449,961 E329G probably benign Het
Hacd1 T C 2: 14,035,944 I167V probably damaging Het
Hdlbp T A 1: 93,417,667 D662V possibly damaging Het
Hspa4 A T 11: 53,265,056 V674E probably benign Het
Hunk A G 16: 90,493,432 Q442R possibly damaging Het
Lce1j A T 3: 92,789,422 C16* probably null Het
Lrat A T 3: 82,903,492 M74K probably damaging Het
Lrig2 G A 3: 104,467,193 R191C probably damaging Het
Lrrc37a A C 11: 103,460,840 F2558L unknown Het
Mctp1 T A 13: 76,731,811 probably null Het
Mecom T A 3: 30,140,386 probably benign Het
Mgst1 A G 6: 138,141,587 probably null Het
Ms4a15 T G 19: 10,993,170 E3A probably benign Het
Myo1d T C 11: 80,557,474 I942V probably benign Het
Neu2 A G 1: 87,596,878 Y195C probably damaging Het
Nipa1 A T 7: 56,019,504 V22E probably benign Het
Olfr1061 T A 2: 86,414,037 N5I probably damaging Het
Olfr781 T C 10: 129,333,711 S277P possibly damaging Het
Pik3r4 A G 9: 105,685,190 T1223A possibly damaging Het
Ppl T C 16: 5,092,441 D811G probably damaging Het
Prep T A 10: 45,115,107 Y290N probably damaging Het
Ptk6 A T 2: 181,199,102 H215Q probably benign Het
Rad50 A G 11: 53,692,144 I474T possibly damaging Het
Rnf213 T A 11: 119,452,687 V3626E possibly damaging Het
Scn4a C T 11: 106,345,676 V253M probably damaging Het
Snta1 T A 2: 154,377,149 D422V probably damaging Het
Stk38 A G 17: 28,984,112 L160P probably benign Het
Tapbp T C 17: 33,926,098 F323S probably damaging Het
Uggt1 C T 1: 36,173,450 R937Q probably benign Het
Vash2 G A 1: 190,978,287 P57L probably damaging Het
Vmn1r4 G A 6: 56,956,867 V119I probably benign Het
Vmn2r74 T C 7: 85,961,391 D31G probably benign Het
Zfp114 T C 7: 24,177,781 V16A possibly damaging Het
Other mutations in Olfr733
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Olfr733 APN 14 50298512 missense probably benign 0.00
IGL02247:Olfr733 APN 14 50299114 missense probably damaging 1.00
IGL02307:Olfr733 APN 14 50298838 missense probably damaging 1.00
IGL02492:Olfr733 APN 14 50298603 missense probably damaging 1.00
PIT4378001:Olfr733 UTSW 14 50298898 missense probably benign
R0544:Olfr733 UTSW 14 50298682 missense probably benign 0.20
R1603:Olfr733 UTSW 14 50299034 missense possibly damaging 0.95
R1881:Olfr733 UTSW 14 50299015 missense probably damaging 1.00
R3731:Olfr733 UTSW 14 50298505 missense probably damaging 1.00
R4271:Olfr733 UTSW 14 50298451 missense probably damaging 1.00
R4512:Olfr733 UTSW 14 50298996 missense probably damaging 1.00
R5601:Olfr733 UTSW 14 50298861 missense probably damaging 1.00
R6614:Olfr733 UTSW 14 50299037 missense probably benign 0.00
R7013:Olfr733 UTSW 14 50299199 missense probably damaging 0.99
R7083:Olfr733 UTSW 14 50299279 missense possibly damaging 0.81
R7274:Olfr733 UTSW 14 50298422 missense probably benign 0.01
R7493:Olfr733 UTSW 14 50298824 missense probably benign 0.02
R7653:Olfr733 UTSW 14 50299147 missense possibly damaging 0.82
R7659:Olfr733 UTSW 14 50299241 missense probably benign 0.00
R7885:Olfr733 UTSW 14 50298584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATGTATAAACGCATCAAGTTGC -3'
(R):5'- AATAGTGGCCTGCTTACCCTTG -3'

Sequencing Primer
(F):5'- GTCAAATCTTTCCTGCCTGA -3'
(R):5'- TATTTTATGCCATGTTCACAGGTCAG -3'
Posted On2018-05-21