Mutagenetix > Incidental Mutations

Incidental Mutation 'R6470:Brinp3'

516456

Institutional Source

Beutler Lab

Gene Symbol

Brinp3

Ensembl Gene

ENSMUSG00000035131

Gene Name

bone morphogenetic protein/retinoic acid inducible neural specific 3

Synonyms

Fam5c, B830045N13Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.208) question?

Stock #

R6470 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

146494760-146902472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 146901906 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 697 (D697G)

Ref Sequence

ENSEMBL: ENSMUSP00000126074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000166814]

Predicted Effect

probably damaging
Transcript: ENSMUST00000074622
AA Change: D697G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: D697G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128345

SMART Domains

Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166814
AA Change: D697G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: D697G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933402J07Rik	G	T	8: 87,564,028	V5L	probably benign	Het
Bptf	A	G	11: 107,072,767	V1804A	probably damaging	Het
Carns1	T	C	19: 4,171,783	T158A	possibly damaging	Het
Cd300lg	A	G	11: 102,050,505	N244S	possibly damaging	Het
Ces3b	A	T	8: 105,088,653	Q12L	possibly damaging	Het
Chd9	A	G	8: 90,932,798	T129A	probably damaging	Het
Clca3a2	T	A	3: 144,804,263		probably null	Het
Cubn	G	T	2: 13,322,993	R2674S	possibly damaging	Het
Cyp2b10	T	C	7: 25,911,656	I146T	possibly damaging	Het
Cyp4v3	C	T	8: 45,317,736	W244*	probably null	Het
Dnah6	T	A	6: 73,074,586	D3075V	probably damaging	Het
Dpy19l2	A	T	9: 24,660,743	I327N	possibly damaging	Het
Dst	T	A	1: 34,295,237	F4849I	probably damaging	Het
Dysf	A	G	6: 84,066,944	I256V	possibly damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Fam71e2	T	C	7: 4,757,851	T621A	probably benign	Het
Gba	C	T	3: 89,204,081	P51L	probably benign	Het
Gm9936	T	C	5: 114,857,421		probably benign	Het
Gria4	A	G	9: 4,503,680	F312S	probably damaging	Het
Ifna2	T	C	4: 88,683,514	N89S	probably benign	Het
Il17rb	A	G	14: 30,002,909	S207P	probably benign	Het
Itga9	A	T	9: 118,897,267	I430F	probably damaging	Het
Kif1b	T	C	4: 149,192,596	M1337V	probably benign	Het
Ltk	A	T	2: 119,753,035		probably null	Het
Nat8l	C	T	5: 33,998,492	T164M	probably damaging	Het
Nrf1	A	G	6: 30,102,200	D166G	probably damaging	Het
Nxph3	A	G	11: 95,511,093	I165T	possibly damaging	Het
Olfr17	T	C	7: 107,097,744	I93T	probably damaging	Het
Phlpp2	A	G	8: 109,937,194	D955G	probably benign	Het
Pianp	T	A	6: 124,999,269		probably benign	Het
Plin2	G	T	4: 86,668,370	Q75K	probably damaging	Het
Qrich1	T	C	9: 108,534,518	V414A	probably damaging	Het
Ros1	A	G	10: 52,166,044		probably null	Het
Sardh	C	T	2: 27,244,372	R44Q	probably damaging	Het
Scaf4	C	T	16: 90,229,638	W1072*	probably null	Het
Sh3rf3	A	G	10: 58,983,969	K201E	probably damaging	Het
Shprh	G	T	10: 11,171,937	A1010S	probably damaging	Het
Slc35d1	A	G	4: 103,189,822	S260P	probably damaging	Het
Smap2	GACTCTAC	GAC	4: 120,973,085		probably benign	Het
Sptb	A	G	12: 76,612,829	L1099P	probably damaging	Het
Srrt	T	C	5: 137,302,656	D90G	probably damaging	Het
Syt10	T	C	15: 89,792,601	D394G	probably damaging	Het
Tlr3	T	C	8: 45,397,385	D301G	probably damaging	Het
Ubr3	T	A	2: 69,965,460	M916K	probably benign	Het

Other mutations in Brinp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Brinp3	APN	1	146901774	missense	probably damaging	0.99
IGL00503:Brinp3	APN	1	146901167	missense	probably benign
IGL01702:Brinp3	APN	1	146751997	splice site	probably benign
IGL01728:Brinp3	APN	1	146831551	splice site	probably null
IGL01733:Brinp3	APN	1	146514803	missense	probably benign	0.33
IGL01937:Brinp3	APN	1	146901140	missense	probably benign
IGL02020:Brinp3	APN	1	146902127	utr 3 prime	probably benign
IGL02082:Brinp3	APN	1	146751862	missense	probably damaging	1.00
IGL02365:Brinp3	APN	1	146901122	missense	probably benign	0.00
IGL02366:Brinp3	APN	1	146701743	missense	possibly damaging	0.84
IGL02565:Brinp3	APN	1	146902032	missense	probably damaging	0.98
IGL02999:Brinp3	APN	1	146701849	splice site	probably null
IGL03099:Brinp3	APN	1	146902097	missense	possibly damaging	0.91
PIT4283001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
PIT4418001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0266:Brinp3	UTSW	1	146682680	nonsense	probably null
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1522:Brinp3	UTSW	1	146901890	missense	probably damaging	0.99
R1596:Brinp3	UTSW	1	146514782	missense	probably benign
R1898:Brinp3	UTSW	1	146901249	missense	possibly damaging	0.93
R2036:Brinp3	UTSW	1	146701841	missense	possibly damaging	0.84
R2224:Brinp3	UTSW	1	146901920	nonsense	probably null
R2272:Brinp3	UTSW	1	146901404	missense	possibly damaging	0.93
R2291:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R2322:Brinp3	UTSW	1	146701754	missense	probably benign
R2880:Brinp3	UTSW	1	146902002	missense	probably damaging	0.98
R3918:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3939:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3940:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3941:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3942:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R4095:Brinp3	UTSW	1	146901692	missense	possibly damaging	0.72
R4783:Brinp3	UTSW	1	146727640	intron	probably benign
R5009:Brinp3	UTSW	1	146901049	missense	probably benign	0.25
R5034:Brinp3	UTSW	1	146727720	intron	probably benign
R5166:Brinp3	UTSW	1	146901367	missense	probably damaging	0.96
R5372:Brinp3	UTSW	1	146831726	missense	probably damaging	1.00
R5472:Brinp3	UTSW	1	146901459	missense	possibly damaging	0.86
R5651:Brinp3	UTSW	1	146701799	missense	probably benign	0.01
R5681:Brinp3	UTSW	1	146901746	missense	probably benign	0.12
R6351:Brinp3	UTSW	1	146901585	missense	probably damaging	0.96
R6499:Brinp3	UTSW	1	146901693	missense	possibly damaging	0.86
R7078:Brinp3	UTSW	1	146514889	nonsense	probably null
R7223:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R7322:Brinp3	UTSW	1	146682688	nonsense	probably null
R7347:Brinp3	UTSW	1	146902086	missense	probably benign	0.22
R7375:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7412:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7532:Brinp3	UTSW	1	146901401	missense	probably damaging	0.98
R7562:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7576:Brinp3	UTSW	1	146901563	missense	probably damaging	0.99
R7723:Brinp3	UTSW	1	146701671	missense	probably damaging	1.00
R7737:Brinp3	UTSW	1	146682594	missense	probably damaging	0.98
R7793:Brinp3	UTSW	1	146746568	missense	probably benign	0.20
R8334:Brinp3	UTSW	1	146902053	missense	probably damaging	0.99
R8401:Brinp3	UTSW	1	146901446	missense	probably benign	0.17
X0060:Brinp3	UTSW	1	146901786	missense	probably benign	0.01
Z1176:Brinp3	UTSW	1	146902076	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CATCTACCTGAGGAGTCGCATC -3'
(R):5'- ATAATCCACTGTGTTTGGCAAC -3'

Sequencing Primer
(F):5'- TCGCATCAAGGCAAATGGC -3'
(R):5'- CACTGTGTTTGGCAACTTGGC -3'

Posted On

2018-05-21