Incidental Mutation 'R6470:Cyp4v3'
ID516476
Institutional Source Beutler Lab
Gene Symbol Cyp4v3
Ensembl Gene ENSMUSG00000079057
Gene Namecytochrome P450, family 4, subfamily v, polypeptide 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6470 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location45304944-45333216 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 45317736 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 244 (W244*)
Ref Sequence ENSEMBL: ENSMUSP00000092966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095328]
Predicted Effect probably null
Transcript: ENSMUST00000095328
AA Change: W244*
SMART Domains Protein: ENSMUSP00000092966
Gene: ENSMUSG00000079057
AA Change: W244*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 51 517 2.7e-123 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 hemethiolate protein superfamily which are involved in oxidizing various substrates in the metabolic pathway. It is implicated in the metabolism of fatty acid precursors into n-3 polyunsaturated fatty acids. Mutations in this gene result in Bietti crystalline corneoretinal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit corneoretinal crystal accumulation and systemic dyslipidemia characteristic of Bietti Crystalline Dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik G T 8: 87,564,028 V5L probably benign Het
Bptf A G 11: 107,072,767 V1804A probably damaging Het
Brinp3 A G 1: 146,901,906 D697G probably damaging Het
Carns1 T C 19: 4,171,783 T158A possibly damaging Het
Cd300lg A G 11: 102,050,505 N244S possibly damaging Het
Ces3b A T 8: 105,088,653 Q12L possibly damaging Het
Chd9 A G 8: 90,932,798 T129A probably damaging Het
Clca3a2 T A 3: 144,804,263 probably null Het
Cubn G T 2: 13,322,993 R2674S possibly damaging Het
Cyp2b10 T C 7: 25,911,656 I146T possibly damaging Het
Dnah6 T A 6: 73,074,586 D3075V probably damaging Het
Dpy19l2 A T 9: 24,660,743 I327N possibly damaging Het
Dst T A 1: 34,295,237 F4849I probably damaging Het
Dysf A G 6: 84,066,944 I256V possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam71e2 T C 7: 4,757,851 T621A probably benign Het
Gba C T 3: 89,204,081 P51L probably benign Het
Gm9936 T C 5: 114,857,421 probably benign Het
Gria4 A G 9: 4,503,680 F312S probably damaging Het
Ifna2 T C 4: 88,683,514 N89S probably benign Het
Il17rb A G 14: 30,002,909 S207P probably benign Het
Itga9 A T 9: 118,897,267 I430F probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Ltk A T 2: 119,753,035 probably null Het
Nat8l C T 5: 33,998,492 T164M probably damaging Het
Nrf1 A G 6: 30,102,200 D166G probably damaging Het
Nxph3 A G 11: 95,511,093 I165T possibly damaging Het
Olfr17 T C 7: 107,097,744 I93T probably damaging Het
Phlpp2 A G 8: 109,937,194 D955G probably benign Het
Pianp T A 6: 124,999,269 probably benign Het
Plin2 G T 4: 86,668,370 Q75K probably damaging Het
Qrich1 T C 9: 108,534,518 V414A probably damaging Het
Ros1 A G 10: 52,166,044 probably null Het
Sardh C T 2: 27,244,372 R44Q probably damaging Het
Scaf4 C T 16: 90,229,638 W1072* probably null Het
Sh3rf3 A G 10: 58,983,969 K201E probably damaging Het
Shprh G T 10: 11,171,937 A1010S probably damaging Het
Slc35d1 A G 4: 103,189,822 S260P probably damaging Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Sptb A G 12: 76,612,829 L1099P probably damaging Het
Srrt T C 5: 137,302,656 D90G probably damaging Het
Syt10 T C 15: 89,792,601 D394G probably damaging Het
Tlr3 T C 8: 45,397,385 D301G probably damaging Het
Ubr3 T A 2: 69,965,460 M916K probably benign Het
Other mutations in Cyp4v3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Cyp4v3 APN 8 45307003 missense probably benign 0.04
IGL00503:Cyp4v3 APN 8 45307021 missense probably damaging 0.98
IGL00757:Cyp4v3 APN 8 45320615 missense probably damaging 0.98
IGL02375:Cyp4v3 APN 8 45308374 splice site probably null
IGL02565:Cyp4v3 APN 8 45320637 missense possibly damaging 0.63
IGL02881:Cyp4v3 APN 8 45308716 missense probably damaging 1.00
R0745:Cyp4v3 UTSW 8 45308651 unclassified probably benign
R1818:Cyp4v3 UTSW 8 45315636 missense possibly damaging 0.77
R1819:Cyp4v3 UTSW 8 45315636 missense possibly damaging 0.77
R1902:Cyp4v3 UTSW 8 45306952 missense probably benign 0.00
R2426:Cyp4v3 UTSW 8 45317776 missense probably benign
R3747:Cyp4v3 UTSW 8 45315708 nonsense probably null
R3748:Cyp4v3 UTSW 8 45315708 nonsense probably null
R3750:Cyp4v3 UTSW 8 45315708 nonsense probably null
R4289:Cyp4v3 UTSW 8 45328223 missense possibly damaging 0.46
R4569:Cyp4v3 UTSW 8 45306992 missense probably damaging 1.00
R4960:Cyp4v3 UTSW 8 45320637 missense possibly damaging 0.63
R5260:Cyp4v3 UTSW 8 45306980 missense probably damaging 1.00
R5479:Cyp4v3 UTSW 8 45310206 missense probably benign 0.00
R5667:Cyp4v3 UTSW 8 45308535 missense possibly damaging 0.94
R5940:Cyp4v3 UTSW 8 45321784 missense probably damaging 1.00
R6102:Cyp4v3 UTSW 8 45320160 missense probably damaging 1.00
R6592:Cyp4v3 UTSW 8 45306981 missense probably benign 0.02
R6700:Cyp4v3 UTSW 8 45307093 missense probably damaging 1.00
R7027:Cyp4v3 UTSW 8 45310252 missense possibly damaging 0.93
R7341:Cyp4v3 UTSW 8 45321750 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCCTACATCTGGGTTTCC -3'
(R):5'- GCATTGAAGAGCAATCGGC -3'

Sequencing Primer
(F):5'- TCCTGGACTGAAGAATATCCTAAG -3'
(R):5'- CATTGAAGAGCAATCGGCAACATTTC -3'
Posted On2018-05-21