Incidental Mutation 'R6470:Dpy19l2'
ID516483
Institutional Source Beutler Lab
Gene Symbol Dpy19l2
Ensembl Gene ENSMUSG00000085576
Gene Namedpy-19-like 2 (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6470 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location24557047-24696293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24660743 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 327 (I327N)
Ref Sequence ENSEMBL: ENSMUSP00000132092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133010]
Predicted Effect possibly damaging
Transcript: ENSMUST00000133010
AA Change: I327N

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132092
Gene: ENSMUSG00000085576
AA Change: I327N

DomainStartEndE-ValueType
Pfam:Dpy19 129 772 3.1e-233 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dpy-19 family. It is highly expressed in testis, and is required for sperm head elongation and acrosome formation during spermatogenesis. Mutations in this gene are associated with an infertility disorder, spermatogenic failure type 9 (SPGF9). [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male sterility associated with globozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik G T 8: 87,564,028 V5L probably benign Het
Bptf A G 11: 107,072,767 V1804A probably damaging Het
Brinp3 A G 1: 146,901,906 D697G probably damaging Het
Carns1 T C 19: 4,171,783 T158A possibly damaging Het
Cd300lg A G 11: 102,050,505 N244S possibly damaging Het
Ces3b A T 8: 105,088,653 Q12L possibly damaging Het
Chd9 A G 8: 90,932,798 T129A probably damaging Het
Clca3a2 T A 3: 144,804,263 probably null Het
Cubn G T 2: 13,322,993 R2674S possibly damaging Het
Cyp2b10 T C 7: 25,911,656 I146T possibly damaging Het
Cyp4v3 C T 8: 45,317,736 W244* probably null Het
Dnah6 T A 6: 73,074,586 D3075V probably damaging Het
Dst T A 1: 34,295,237 F4849I probably damaging Het
Dysf A G 6: 84,066,944 I256V possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam71e2 T C 7: 4,757,851 T621A probably benign Het
Gba C T 3: 89,204,081 P51L probably benign Het
Gm9936 T C 5: 114,857,421 probably benign Het
Gria4 A G 9: 4,503,680 F312S probably damaging Het
Ifna2 T C 4: 88,683,514 N89S probably benign Het
Il17rb A G 14: 30,002,909 S207P probably benign Het
Itga9 A T 9: 118,897,267 I430F probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Ltk A T 2: 119,753,035 probably null Het
Nat8l C T 5: 33,998,492 T164M probably damaging Het
Nrf1 A G 6: 30,102,200 D166G probably damaging Het
Nxph3 A G 11: 95,511,093 I165T possibly damaging Het
Olfr17 T C 7: 107,097,744 I93T probably damaging Het
Phlpp2 A G 8: 109,937,194 D955G probably benign Het
Pianp T A 6: 124,999,269 probably benign Het
Plin2 G T 4: 86,668,370 Q75K probably damaging Het
Qrich1 T C 9: 108,534,518 V414A probably damaging Het
Ros1 A G 10: 52,166,044 probably null Het
Sardh C T 2: 27,244,372 R44Q probably damaging Het
Scaf4 C T 16: 90,229,638 W1072* probably null Het
Sh3rf3 A G 10: 58,983,969 K201E probably damaging Het
Shprh G T 10: 11,171,937 A1010S probably damaging Het
Slc35d1 A G 4: 103,189,822 S260P probably damaging Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Sptb A G 12: 76,612,829 L1099P probably damaging Het
Srrt T C 5: 137,302,656 D90G probably damaging Het
Syt10 T C 15: 89,792,601 D394G probably damaging Het
Tlr3 T C 8: 45,397,385 D301G probably damaging Het
Ubr3 T A 2: 69,965,460 M916K probably benign Het
Other mutations in Dpy19l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Dpy19l2 APN 9 24582818 missense probably damaging 1.00
IGL01137:Dpy19l2 APN 9 24658562 missense possibly damaging 0.78
IGL01586:Dpy19l2 APN 9 24666975 missense probably benign 0.16
IGL02245:Dpy19l2 APN 9 24696025 missense probably benign
IGL02507:Dpy19l2 APN 9 24631267 missense probably benign 0.01
IGL02541:Dpy19l2 APN 9 24658647 missense probably benign 0.00
IGL02644:Dpy19l2 APN 9 24658592 missense probably damaging 1.00
IGL03144:Dpy19l2 APN 9 24646307 missense possibly damaging 0.92
R0022:Dpy19l2 UTSW 9 24696124 missense probably benign
R0029:Dpy19l2 UTSW 9 24558101 missense probably damaging 0.97
R0066:Dpy19l2 UTSW 9 24646383 splice site probably benign
R0066:Dpy19l2 UTSW 9 24646383 splice site probably benign
R0089:Dpy19l2 UTSW 9 24695793 missense probably benign 0.01
R0240:Dpy19l2 UTSW 9 24658580 missense probably damaging 1.00
R0240:Dpy19l2 UTSW 9 24658580 missense probably damaging 1.00
R0349:Dpy19l2 UTSW 9 24695922 missense possibly damaging 0.89
R0491:Dpy19l2 UTSW 9 24696028 missense probably benign 0.09
R0519:Dpy19l2 UTSW 9 24558095 missense probably benign 0.30
R1398:Dpy19l2 UTSW 9 24581263 splice site probably benign
R1465:Dpy19l2 UTSW 9 24669322 missense probably benign 0.04
R1465:Dpy19l2 UTSW 9 24669322 missense probably benign 0.04
R1576:Dpy19l2 UTSW 9 24584502 missense probably benign
R1606:Dpy19l2 UTSW 9 24581215 missense probably benign
R2157:Dpy19l2 UTSW 9 24584632 missense probably benign 0.00
R2157:Dpy19l2 UTSW 9 24680780 missense probably benign 0.02
R2402:Dpy19l2 UTSW 9 24581248 missense probably damaging 1.00
R2409:Dpy19l2 UTSW 9 24658628 missense probably benign 0.00
R3196:Dpy19l2 UTSW 9 24695989 missense probably damaging 1.00
R3419:Dpy19l2 UTSW 9 24581205 missense probably damaging 1.00
R4884:Dpy19l2 UTSW 9 24628180 nonsense probably null
R5289:Dpy19l2 UTSW 9 24695997 missense probably benign
R5950:Dpy19l2 UTSW 9 24581134 missense probably benign 0.10
R7028:Dpy19l2 UTSW 9 24628251 missense probably benign 0.15
R7051:Dpy19l2 UTSW 9 24584493 missense probably benign 0.00
R7095:Dpy19l2 UTSW 9 24695814 missense probably benign 0.41
R7649:Dpy19l2 UTSW 9 24696163 start codon destroyed probably null 0.53
X0067:Dpy19l2 UTSW 9 24585537 missense probably benign 0.00
Z1088:Dpy19l2 UTSW 9 24660824 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTCAGAAGCCTGTGAATGGG -3'
(R):5'- AGAAGCTATGCCAGGCAGTG -3'

Sequencing Primer
(F):5'- TGCATACAGTGATCGTGCAC -3'
(R):5'- CTATGCCAGGCAGTGAGAAATAG -3'
Posted On2018-05-21