Incidental Mutation 'R6457:1110002E22Rik'
List |< first << previous [record 138 of 468117] next >> last >|
ID516515
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.454) question?
Stock #R6457 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 138066622 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 524 (V524E)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: V524E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: V524E

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184925
Meta Mutation Damage Score 0.0995 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,900,571 M152K probably damaging Het
Actn3 T C 19: 4,871,848 D130G probably damaging Het
Ank1 T A 8: 23,087,967 F211Y probably damaging Het
Ankfn1 C T 11: 89,391,844 A326T probably benign Het
Ankrd11 G A 8: 122,908,764 R44C probably damaging Het
Ankrd46 A G 15: 36,484,071 probably benign Het
Aurkb G A 11: 69,048,346 E132K possibly damaging Het
Bsdc1 C T 4: 129,465,276 T9I possibly damaging Het
Card14 C T 11: 119,339,602 R767* probably null Het
Ccdc82 T A 9: 13,272,426 F411L possibly damaging Het
Col12a1 C T 9: 79,645,691 G2106D probably damaging Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cox10 A G 11: 63,964,372 L361P probably damaging Het
Cox18 A G 5: 90,223,689 I84T probably benign Het
Dhrs3 T C 4: 144,919,952 S125P probably damaging Het
Fbxl15 A G 19: 46,329,326 H149R probably benign Het
Flg2 T A 3: 93,220,482 S2234T unknown Het
Gtf2e1 A C 16: 37,536,336 probably null Het
H2-Q7 A T 17: 35,439,679 S98C probably damaging Het
Hcn2 G T 10: 79,733,773 E536* probably null Het
Kat6b A T 14: 21,670,680 H1700L probably damaging Het
Klhl3 C T 13: 58,100,378 V35I probably benign Het
Krt34 A T 11: 100,040,090 L162Q probably damaging Het
Ly9 A G 1: 171,589,095 S644P probably damaging Het
Magi1 A T 6: 93,699,639 V685E probably damaging Het
Malrd1 A G 2: 15,526,597 probably benign Het
Malrd1 A T 2: 15,667,929 H599L probably benign Het
Matn2 T A 15: 34,426,234 C631S probably damaging Het
Megf8 A T 7: 25,349,695 D1739V probably damaging Het
Mlf1 G A 3: 67,392,944 R98Q probably benign Het
Mprip T A 11: 59,758,989 I1173K possibly damaging Het
Mrc1 A G 2: 14,270,205 D439G probably damaging Het
Mroh5 A T 15: 73,790,842 W208R probably damaging Het
Ms4a5 T G 19: 11,279,282 I84L probably benign Het
Myt1 G A 2: 181,763,425 probably null Het
Nbea T A 3: 56,000,569 H1374L probably damaging Het
Nbeal1 T A 1: 60,253,474 I1095K probably benign Het
Nolc1 A G 19: 46,083,070 probably benign Het
Nr5a2 A G 1: 136,960,238 L18P probably benign Het
Nup188 G T 2: 30,322,187 C562F probably damaging Het
Obscn A G 11: 59,080,771 V2415A probably damaging Het
Pacsin2 A T 15: 83,379,678 probably null Het
Pias3 A G 3: 96,699,523 H34R possibly damaging Het
Ppfia2 T C 10: 106,893,500 V903A probably damaging Het
Pramel1 T A 4: 143,396,705 L84Q probably damaging Het
Pramel6 G A 2: 87,509,438 C182Y probably damaging Het
Prdm4 A G 10: 85,908,032 Y120H probably damaging Het
Prss28 A G 17: 25,311,357 M212V probably benign Het
Rbp3 G T 14: 33,955,267 G391* probably null Het
Rc3h2 C T 2: 37,411,139 probably null Het
Ret A G 6: 118,173,621 F645L probably benign Het
Sgsm2 A G 11: 74,865,169 S402P possibly damaging Het
Shc3 T A 13: 51,482,879 probably null Het
Slc25a16 A G 10: 62,941,159 N246S probably benign Het
Snrpd1 T A 18: 10,623,694 H26Q probably benign Het
Tex45 T C 8: 3,479,268 L251P probably damaging Het
Thsd1 A G 8: 22,243,347 T137A probably damaging Het
Tnik A T 3: 28,539,448 H151L probably damaging Het
Tns1 T A 1: 73,918,050 K1725N probably damaging Het
Tomm40l T A 1: 171,220,592 T147S probably damaging Het
Tomm6 G T 17: 47,688,007 probably benign Het
Trp53 G A 11: 69,589,614 C272Y probably damaging Het
Trpm7 A T 2: 126,807,294 V1492E probably benign Het
Tsen2 G A 6: 115,559,631 R116H probably benign Het
Uvrag A G 7: 98,906,519 F456S probably damaging Het
Vmn1r86 A T 7: 13,102,352 M199K possibly damaging Het
Vmn2r4 C T 3: 64,409,957 C120Y probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGAGACCCCAGGAGACATC -3'
(R):5'- GTAGTCCACCAGCTCCTTTG -3'

Sequencing Primer
(F):5'- GATGACAATAGCTGTTACGTCAG -3'
(R):5'- AGCTCCTTTGCCCGGATG -3'
Posted On2018-05-21