Incidental Mutation 'R6457:Pramel1'
ID516519
Institutional Source Beutler Lab
Gene Symbol Pramel1
Ensembl Gene ENSMUSG00000041805
Gene Namepreferentially expressed antigen in melanoma-like 1
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_031377.2; MGI:1890541

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6457 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location143394428-143400160 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143396705 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 84 (L84Q)
Ref Sequence ENSEMBL: ENSMUSP00000043718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037419]
Predicted Effect probably damaging
Transcript: ENSMUST00000037419
AA Change: L84Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043718
Gene: ENSMUSG00000041805
AA Change: L84Q

DomainStartEndE-ValueType
SCOP:d1a4ya_ 203 396 1e-13 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,622 V524E probably damaging Het
Acer2 T A 4: 86,900,571 M152K probably damaging Het
Actn3 T C 19: 4,871,848 D130G probably damaging Het
Ank1 T A 8: 23,087,967 F211Y probably damaging Het
Ankfn1 C T 11: 89,391,844 A326T probably benign Het
Ankrd11 G A 8: 122,908,764 R44C probably damaging Het
Ankrd46 A G 15: 36,484,071 probably benign Het
Aurkb G A 11: 69,048,346 E132K possibly damaging Het
Bsdc1 C T 4: 129,465,276 T9I possibly damaging Het
Card14 C T 11: 119,339,602 R767* probably null Het
Ccdc82 T A 9: 13,272,426 F411L possibly damaging Het
Col12a1 C T 9: 79,645,691 G2106D probably damaging Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cox10 A G 11: 63,964,372 L361P probably damaging Het
Cox18 A G 5: 90,223,689 I84T probably benign Het
Dhrs3 T C 4: 144,919,952 S125P probably damaging Het
Fbxl15 A G 19: 46,329,326 H149R probably benign Het
Flg2 T A 3: 93,220,482 S2234T unknown Het
Gtf2e1 A C 16: 37,536,336 probably null Het
H2-Q7 A T 17: 35,439,679 S98C probably damaging Het
Hcn2 G T 10: 79,733,773 E536* probably null Het
Kat6b A T 14: 21,670,680 H1700L probably damaging Het
Klhl3 C T 13: 58,100,378 V35I probably benign Het
Krt34 A T 11: 100,040,090 L162Q probably damaging Het
Ly9 A G 1: 171,589,095 S644P probably damaging Het
Magi1 A T 6: 93,699,639 V685E probably damaging Het
Malrd1 A G 2: 15,526,597 probably benign Het
Malrd1 A T 2: 15,667,929 H599L probably benign Het
Matn2 T A 15: 34,426,234 C631S probably damaging Het
Megf8 A T 7: 25,349,695 D1739V probably damaging Het
Mlf1 G A 3: 67,392,944 R98Q probably benign Het
Mprip T A 11: 59,758,989 I1173K possibly damaging Het
Mrc1 A G 2: 14,270,205 D439G probably damaging Het
Mroh5 A T 15: 73,790,842 W208R probably damaging Het
Ms4a5 T G 19: 11,279,282 I84L probably benign Het
Myt1 G A 2: 181,763,425 probably null Het
Nbea T A 3: 56,000,569 H1374L probably damaging Het
Nbeal1 T A 1: 60,253,474 I1095K probably benign Het
Nolc1 A G 19: 46,083,070 probably benign Het
Nr5a2 A G 1: 136,960,238 L18P probably benign Het
Nup188 G T 2: 30,322,187 C562F probably damaging Het
Obscn A G 11: 59,080,771 V2415A probably damaging Het
Pacsin2 A T 15: 83,379,678 probably null Het
Pias3 A G 3: 96,699,523 H34R possibly damaging Het
Ppfia2 T C 10: 106,893,500 V903A probably damaging Het
Pramel6 G A 2: 87,509,438 C182Y probably damaging Het
Prdm4 A G 10: 85,908,032 Y120H probably damaging Het
Prss28 A G 17: 25,311,357 M212V probably benign Het
Rbp3 G T 14: 33,955,267 G391* probably null Het
Rc3h2 C T 2: 37,411,139 probably null Het
Ret A G 6: 118,173,621 F645L probably benign Het
Sgsm2 A G 11: 74,865,169 S402P possibly damaging Het
Shc3 T A 13: 51,482,879 probably null Het
Slc25a16 A G 10: 62,941,159 N246S probably benign Het
Snrpd1 T A 18: 10,623,694 H26Q probably benign Het
Tex45 T C 8: 3,479,268 L251P probably damaging Het
Thsd1 A G 8: 22,243,347 T137A probably damaging Het
Tnik A T 3: 28,539,448 H151L probably damaging Het
Tns1 T A 1: 73,918,050 K1725N probably damaging Het
Tomm40l T A 1: 171,220,592 T147S probably damaging Het
Tomm6 G T 17: 47,688,007 probably benign Het
Trp53 G A 11: 69,589,614 C272Y probably damaging Het
Trpm7 A T 2: 126,807,294 V1492E probably benign Het
Tsen2 G A 6: 115,559,631 R116H probably benign Het
Uvrag A G 7: 98,906,519 F456S probably damaging Het
Vmn1r86 A T 7: 13,102,352 M199K possibly damaging Het
Vmn2r4 C T 3: 64,409,957 C120Y probably damaging Het
Other mutations in Pramel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Pramel1 APN 4 143397556 missense probably damaging 1.00
IGL01363:Pramel1 APN 4 143397385 missense probably benign 0.00
IGL01713:Pramel1 APN 4 143397082 missense probably benign 0.01
IGL02334:Pramel1 APN 4 143397526 missense probably damaging 0.98
IGL02957:Pramel1 APN 4 143397598 missense probably benign 0.22
P0045:Pramel1 UTSW 4 143398522 nonsense probably null
PIT4431001:Pramel1 UTSW 4 143398390 missense possibly damaging 0.61
R0136:Pramel1 UTSW 4 143397446 missense probably damaging 1.00
R0544:Pramel1 UTSW 4 143397605 missense possibly damaging 0.94
R0612:Pramel1 UTSW 4 143397531 missense probably damaging 0.99
R1700:Pramel1 UTSW 4 143398429 missense probably damaging 1.00
R2425:Pramel1 UTSW 4 143398466 missense probably damaging 1.00
R2927:Pramel1 UTSW 4 143398818 missense probably benign
R4012:Pramel1 UTSW 4 143396690 missense possibly damaging 0.48
R5253:Pramel1 UTSW 4 143398586 missense probably benign 0.03
R5388:Pramel1 UTSW 4 143397384 missense probably benign 0.00
R7052:Pramel1 UTSW 4 143396504 missense probably damaging 1.00
R7543:Pramel1 UTSW 4 143398423 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCTGGATGACATACCCTCAC -3'
(R):5'- CCACTGCTGATAAACCCTGC -3'

Sequencing Primer
(F):5'- TGGATGACATACCCTCACTTTTC -3'
(R):5'- TTCCCAGATGGCTCAGCAATG -3'
Posted On2018-05-21