Incidental Mutation 'R6457:Dhrs3'
ID516520
Institutional Source Beutler Lab
Gene Symbol Dhrs3
Ensembl Gene ENSMUSG00000066026
Gene Namedehydrogenase/reductase (SDR family) member 3
SynonymsRsdr1, retSDR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6457 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location144892827-144928209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144919952 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 125 (S125P)
Ref Sequence ENSEMBL: ENSMUSP00000101370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084184] [ENSMUST00000105744] [ENSMUST00000142808] [ENSMUST00000154208] [ENSMUST00000171001]
Predicted Effect probably benign
Transcript: ENSMUST00000084184
SMART Domains Protein: ENSMUSP00000081200
Gene: ENSMUSG00000066026

DomainStartEndE-ValueType
Pfam:adh_short 39 121 1.7e-19 PFAM
Pfam:KR 40 119 1.5e-16 PFAM
Pfam:Polysacc_synt_2 41 121 1.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105744
AA Change: S125P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101370
Gene: ENSMUSG00000066026
AA Change: S125P

DomainStartEndE-ValueType
Pfam:adh_short 13 92 2.1e-18 PFAM
Pfam:KR 14 93 1.5e-15 PFAM
Pfam:Polysacc_synt_2 15 90 4.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133265
Predicted Effect probably benign
Transcript: ENSMUST00000142808
SMART Domains Protein: ENSMUSP00000122578
Gene: ENSMUSG00000066026

DomainStartEndE-ValueType
Pfam:adh_short 13 146 6.1e-29 PFAM
Pfam:KR 14 139 5.9e-20 PFAM
Pfam:Polysacc_synt_2 15 109 4.2e-10 PFAM
Pfam:Epimerase 15 124 3.8e-8 PFAM
Pfam:adh_short_C2 19 146 3.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154208
AA Change: S191P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122552
Gene: ENSMUSG00000066026
AA Change: S191P

DomainStartEndE-ValueType
Pfam:adh_short 39 233 7.8e-42 PFAM
Pfam:KR 40 213 2.3e-21 PFAM
Pfam:Polysacc_synt_2 41 132 2.8e-9 PFAM
Pfam:adh_short_C2 45 205 4.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171001
AA Change: S165P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126154
Gene: ENSMUSG00000066026
AA Change: S165P

DomainStartEndE-ValueType
Pfam:adh_short 13 181 2.1e-34 PFAM
Pfam:KR 14 191 2.7e-21 PFAM
Pfam:Polysacc_synt_2 15 106 1.8e-9 PFAM
Pfam:Epimerase 15 124 2e-7 PFAM
Pfam:adh_short_C2 19 179 2e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Short-chain dehydrogenases/reductases (SDRs), such as DHRS3, catalyze the oxidation/reduction of a wide range of substrates, including retinoids and steroids (Haeseleer and Palczewski, 2000 [PubMed 10800688]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a targeted mutation die before weaning age. Mice homozygous for a gene trap allele exhibit perinatal lethality, altered retinoid metabolism and heart, craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,622 V524E probably damaging Het
Acer2 T A 4: 86,900,571 M152K probably damaging Het
Actn3 T C 19: 4,871,848 D130G probably damaging Het
Ank1 T A 8: 23,087,967 F211Y probably damaging Het
Ankfn1 C T 11: 89,391,844 A326T probably benign Het
Ankrd11 G A 8: 122,908,764 R44C probably damaging Het
Ankrd46 A G 15: 36,484,071 probably benign Het
Aurkb G A 11: 69,048,346 E132K possibly damaging Het
Bsdc1 C T 4: 129,465,276 T9I possibly damaging Het
Card14 C T 11: 119,339,602 R767* probably null Het
Ccdc82 T A 9: 13,272,426 F411L possibly damaging Het
Col12a1 C T 9: 79,645,691 G2106D probably damaging Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cox10 A G 11: 63,964,372 L361P probably damaging Het
Cox18 A G 5: 90,223,689 I84T probably benign Het
Fbxl15 A G 19: 46,329,326 H149R probably benign Het
Flg2 T A 3: 93,220,482 S2234T unknown Het
Gtf2e1 A C 16: 37,536,336 probably null Het
H2-Q7 A T 17: 35,439,679 S98C probably damaging Het
Hcn2 G T 10: 79,733,773 E536* probably null Het
Kat6b A T 14: 21,670,680 H1700L probably damaging Het
Klhl3 C T 13: 58,100,378 V35I probably benign Het
Krt34 A T 11: 100,040,090 L162Q probably damaging Het
Ly9 A G 1: 171,589,095 S644P probably damaging Het
Magi1 A T 6: 93,699,639 V685E probably damaging Het
Malrd1 A G 2: 15,526,597 probably benign Het
Malrd1 A T 2: 15,667,929 H599L probably benign Het
Matn2 T A 15: 34,426,234 C631S probably damaging Het
Megf8 A T 7: 25,349,695 D1739V probably damaging Het
Mlf1 G A 3: 67,392,944 R98Q probably benign Het
Mprip T A 11: 59,758,989 I1173K possibly damaging Het
Mrc1 A G 2: 14,270,205 D439G probably damaging Het
Mroh5 A T 15: 73,790,842 W208R probably damaging Het
Ms4a5 T G 19: 11,279,282 I84L probably benign Het
Myt1 G A 2: 181,763,425 probably null Het
Nbea T A 3: 56,000,569 H1374L probably damaging Het
Nbeal1 T A 1: 60,253,474 I1095K probably benign Het
Nolc1 A G 19: 46,083,070 probably benign Het
Nr5a2 A G 1: 136,960,238 L18P probably benign Het
Nup188 G T 2: 30,322,187 C562F probably damaging Het
Obscn A G 11: 59,080,771 V2415A probably damaging Het
Pacsin2 A T 15: 83,379,678 probably null Het
Pias3 A G 3: 96,699,523 H34R possibly damaging Het
Ppfia2 T C 10: 106,893,500 V903A probably damaging Het
Pramel1 T A 4: 143,396,705 L84Q probably damaging Het
Pramel6 G A 2: 87,509,438 C182Y probably damaging Het
Prdm4 A G 10: 85,908,032 Y120H probably damaging Het
Prss28 A G 17: 25,311,357 M212V probably benign Het
Rbp3 G T 14: 33,955,267 G391* probably null Het
Rc3h2 C T 2: 37,411,139 probably null Het
Ret A G 6: 118,173,621 F645L probably benign Het
Sgsm2 A G 11: 74,865,169 S402P possibly damaging Het
Shc3 T A 13: 51,482,879 probably null Het
Slc25a16 A G 10: 62,941,159 N246S probably benign Het
Snrpd1 T A 18: 10,623,694 H26Q probably benign Het
Tex45 T C 8: 3,479,268 L251P probably damaging Het
Thsd1 A G 8: 22,243,347 T137A probably damaging Het
Tnik A T 3: 28,539,448 H151L probably damaging Het
Tns1 T A 1: 73,918,050 K1725N probably damaging Het
Tomm40l T A 1: 171,220,592 T147S probably damaging Het
Tomm6 G T 17: 47,688,007 probably benign Het
Trp53 G A 11: 69,589,614 C272Y probably damaging Het
Trpm7 A T 2: 126,807,294 V1492E probably benign Het
Tsen2 G A 6: 115,559,631 R116H probably benign Het
Uvrag A G 7: 98,906,519 F456S probably damaging Het
Vmn1r86 A T 7: 13,102,352 M199K possibly damaging Het
Vmn2r4 C T 3: 64,409,957 C120Y probably damaging Het
Other mutations in Dhrs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01730:Dhrs3 APN 4 144919472 missense probably damaging 0.96
IGL02226:Dhrs3 APN 4 144923949 missense possibly damaging 0.94
IGL02236:Dhrs3 APN 4 144893563 missense probably benign
IGL02728:Dhrs3 APN 4 144920072 missense probably damaging 0.98
R0079:Dhrs3 UTSW 4 144920048 missense probably damaging 0.99
R0734:Dhrs3 UTSW 4 144927176 missense probably damaging 0.99
R1474:Dhrs3 UTSW 4 144919487 missense probably damaging 1.00
R1632:Dhrs3 UTSW 4 144893546 missense probably benign 0.30
R2010:Dhrs3 UTSW 4 144927188 missense possibly damaging 0.49
R3162:Dhrs3 UTSW 4 144919446 missense possibly damaging 0.80
R3162:Dhrs3 UTSW 4 144919446 missense possibly damaging 0.80
R3176:Dhrs3 UTSW 4 144923940 missense probably benign 0.00
R3276:Dhrs3 UTSW 4 144923940 missense probably benign 0.00
R3440:Dhrs3 UTSW 4 144920058 missense probably damaging 1.00
R3709:Dhrs3 UTSW 4 144893711 critical splice donor site probably null
R3795:Dhrs3 UTSW 4 144919392 missense probably damaging 0.99
R5571:Dhrs3 UTSW 4 144893564 missense probably benign 0.34
R5943:Dhrs3 UTSW 4 144919976 missense possibly damaging 0.88
R7607:Dhrs3 UTSW 4 144923940 missense probably benign 0.00
R8144:Dhrs3 UTSW 4 144919904 missense probably damaging 1.00
R8371:Dhrs3 UTSW 4 144919383 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGTTCTTCACAGTGCAGGGG -3'
(R):5'- AGACCAAGGCCAAGGGATTC -3'

Sequencing Primer
(F):5'- CTTCACAGTGCAGGGGTTCAG -3'
(R):5'- CAAGGGATTCTGGGGCTC -3'
Posted On2018-05-21