Incidental Mutation 'R6457:Megf8'
ID516526
Institutional Source Beutler Lab
Gene Symbol Megf8
Ensembl Gene ENSMUSG00000045039
Gene Namemultiple EGF-like-domains 8
SynonymsEgfl4, b2b1702Clo, m687Ddg, b2b288Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R6457 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location25317164-25365917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25349695 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1739 (D1739V)
Ref Sequence ENSEMBL: ENSMUSP00000122192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128119]
Predicted Effect probably damaging
Transcript: ENSMUST00000128119
AA Change: D1739V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122192
Gene: ENSMUSG00000045039
AA Change: D1739V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 33 140 1.24e-15 SMART
EGF 141 170 4.26e0 SMART
EGF 173 203 2.43e1 SMART
Pfam:Kelch_4 227 277 1.3e-11 PFAM
Pfam:Kelch_3 240 287 1.6e-7 PFAM
low complexity region 320 341 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 728 738 N/A INTRINSIC
PSI 847 899 1.37e0 SMART
low complexity region 932 938 N/A INTRINSIC
PSI 949 991 2.11e-2 SMART
PSI 1005 1073 7.82e-1 SMART
EGF_CA 1074 1115 2.62e-9 SMART
EGF 1117 1160 5.4e-2 SMART
EGF_like 1163 1208 4e-1 SMART
EGF_Lam 1211 1259 1.03e-7 SMART
Blast:CUB 1263 1401 1e-30 BLAST
EGF_like 1406 1445 3.29e1 SMART
Pfam:Kelch_4 1509 1564 6.5e-12 PFAM
Pfam:Kelch_3 1520 1574 1.2e-10 PFAM
PSI 1868 1923 2.75e-1 SMART
PSI 2004 2062 1.6e0 SMART
PSI 2064 2121 1.68e-5 SMART
EGF 2125 2164 1.08e-1 SMART
EGF 2166 2194 4.26e0 SMART
EGF 2204 2244 2.2e1 SMART
EGF_like 2248 2321 6.37e-1 SMART
low complexity region 2493 2504 N/A INTRINSIC
low complexity region 2530 2541 N/A INTRINSIC
transmembrane domain 2592 2614 N/A INTRINSIC
low complexity region 2649 2668 N/A INTRINSIC
low complexity region 2674 2702 N/A INTRINSIC
low complexity region 2759 2774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153077
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit varying degrees of heterotaxia and congenital heart defects. Mice homozygous for another ENU-induced mutation exhibit abnormal development and patterning of the peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,622 V524E probably damaging Het
Acer2 T A 4: 86,900,571 M152K probably damaging Het
Actn3 T C 19: 4,871,848 D130G probably damaging Het
Ank1 T A 8: 23,087,967 F211Y probably damaging Het
Ankfn1 C T 11: 89,391,844 A326T probably benign Het
Ankrd11 G A 8: 122,908,764 R44C probably damaging Het
Ankrd46 A G 15: 36,484,071 probably benign Het
Aurkb G A 11: 69,048,346 E132K possibly damaging Het
Bsdc1 C T 4: 129,465,276 T9I possibly damaging Het
Card14 C T 11: 119,339,602 R767* probably null Het
Ccdc82 T A 9: 13,272,426 F411L possibly damaging Het
Col12a1 C T 9: 79,645,691 G2106D probably damaging Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cox10 A G 11: 63,964,372 L361P probably damaging Het
Cox18 A G 5: 90,223,689 I84T probably benign Het
Dhrs3 T C 4: 144,919,952 S125P probably damaging Het
Fbxl15 A G 19: 46,329,326 H149R probably benign Het
Flg2 T A 3: 93,220,482 S2234T unknown Het
Gtf2e1 A C 16: 37,536,336 probably null Het
H2-Q7 A T 17: 35,439,679 S98C probably damaging Het
Hcn2 G T 10: 79,733,773 E536* probably null Het
Kat6b A T 14: 21,670,680 H1700L probably damaging Het
Klhl3 C T 13: 58,100,378 V35I probably benign Het
Krt34 A T 11: 100,040,090 L162Q probably damaging Het
Ly9 A G 1: 171,589,095 S644P probably damaging Het
Magi1 A T 6: 93,699,639 V685E probably damaging Het
Malrd1 A G 2: 15,526,597 probably benign Het
Malrd1 A T 2: 15,667,929 H599L probably benign Het
Matn2 T A 15: 34,426,234 C631S probably damaging Het
Mlf1 G A 3: 67,392,944 R98Q probably benign Het
Mprip T A 11: 59,758,989 I1173K possibly damaging Het
Mrc1 A G 2: 14,270,205 D439G probably damaging Het
Mroh5 A T 15: 73,790,842 W208R probably damaging Het
Ms4a5 T G 19: 11,279,282 I84L probably benign Het
Myt1 G A 2: 181,763,425 probably null Het
Nbea T A 3: 56,000,569 H1374L probably damaging Het
Nbeal1 T A 1: 60,253,474 I1095K probably benign Het
Nolc1 A G 19: 46,083,070 probably benign Het
Nr5a2 A G 1: 136,960,238 L18P probably benign Het
Nup188 G T 2: 30,322,187 C562F probably damaging Het
Obscn A G 11: 59,080,771 V2415A probably damaging Het
Pacsin2 A T 15: 83,379,678 probably null Het
Pias3 A G 3: 96,699,523 H34R possibly damaging Het
Ppfia2 T C 10: 106,893,500 V903A probably damaging Het
Pramel1 T A 4: 143,396,705 L84Q probably damaging Het
Pramel6 G A 2: 87,509,438 C182Y probably damaging Het
Prdm4 A G 10: 85,908,032 Y120H probably damaging Het
Prss28 A G 17: 25,311,357 M212V probably benign Het
Rbp3 G T 14: 33,955,267 G391* probably null Het
Rc3h2 C T 2: 37,411,139 probably null Het
Ret A G 6: 118,173,621 F645L probably benign Het
Sgsm2 A G 11: 74,865,169 S402P possibly damaging Het
Shc3 T A 13: 51,482,879 probably null Het
Slc25a16 A G 10: 62,941,159 N246S probably benign Het
Snrpd1 T A 18: 10,623,694 H26Q probably benign Het
Tex45 T C 8: 3,479,268 L251P probably damaging Het
Thsd1 A G 8: 22,243,347 T137A probably damaging Het
Tnik A T 3: 28,539,448 H151L probably damaging Het
Tns1 T A 1: 73,918,050 K1725N probably damaging Het
Tomm40l T A 1: 171,220,592 T147S probably damaging Het
Tomm6 G T 17: 47,688,007 probably benign Het
Trp53 G A 11: 69,589,614 C272Y probably damaging Het
Trpm7 A T 2: 126,807,294 V1492E probably benign Het
Tsen2 G A 6: 115,559,631 R116H probably benign Het
Uvrag A G 7: 98,906,519 F456S probably damaging Het
Vmn1r86 A T 7: 13,102,352 M199K possibly damaging Het
Vmn2r4 C T 3: 64,409,957 C120Y probably damaging Het
Other mutations in Megf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Megf8 APN 7 25343684 missense possibly damaging 0.87
IGL00696:Megf8 APN 7 25342392 missense probably benign
IGL01021:Megf8 APN 7 25338374 missense probably benign 0.39
IGL01290:Megf8 APN 7 25349658 nonsense probably null
IGL01392:Megf8 APN 7 25363749 missense probably benign 0.03
IGL01410:Megf8 APN 7 25359871 missense probably benign 0.01
IGL01634:Megf8 APN 7 25358781 splice site probably benign
IGL01648:Megf8 APN 7 25327572 missense probably damaging 1.00
IGL01930:Megf8 APN 7 25334861 missense probably damaging 1.00
IGL01954:Megf8 APN 7 25349014 missense possibly damaging 0.94
IGL02150:Megf8 APN 7 25346417 splice site probably null
IGL02192:Megf8 APN 7 25353860 missense probably damaging 1.00
IGL02250:Megf8 APN 7 25342575 missense probably benign 0.02
IGL02301:Megf8 APN 7 25337900 missense probably damaging 0.96
IGL02317:Megf8 APN 7 25363788 missense probably damaging 1.00
IGL02324:Megf8 APN 7 25340448 missense probably benign 0.10
IGL02503:Megf8 APN 7 25363563 missense possibly damaging 0.70
IGL02583:Megf8 APN 7 25355793 missense probably benign
IGL02636:Megf8 APN 7 25358432 missense probably damaging 0.99
IGL02704:Megf8 APN 7 25359782 missense probably damaging 0.97
IGL02898:Megf8 APN 7 25346508 missense possibly damaging 0.79
IGL03082:Megf8 APN 7 25330236 missense probably benign
IGL03182:Megf8 APN 7 25347348 missense possibly damaging 0.92
PIT4810001:Megf8 UTSW 7 25342285 missense probably damaging 1.00
R0076:Megf8 UTSW 7 25353958 critical splice donor site probably null
R0217:Megf8 UTSW 7 25364079 missense probably damaging 0.99
R0514:Megf8 UTSW 7 25364303 missense possibly damaging 0.86
R0561:Megf8 UTSW 7 25328832 missense probably benign 0.21
R0563:Megf8 UTSW 7 25342395 missense probably damaging 1.00
R0601:Megf8 UTSW 7 25328540 missense probably benign 0.03
R0879:Megf8 UTSW 7 25338471 missense possibly damaging 0.58
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1430:Megf8 UTSW 7 25364343 missense possibly damaging 0.86
R1445:Megf8 UTSW 7 25342656 missense probably damaging 0.97
R1533:Megf8 UTSW 7 25334855 missense possibly damaging 0.70
R1606:Megf8 UTSW 7 25358695 missense probably damaging 1.00
R1635:Megf8 UTSW 7 25346747 missense possibly damaging 0.77
R1654:Megf8 UTSW 7 25338486 missense possibly damaging 0.56
R1661:Megf8 UTSW 7 25363847 missense probably damaging 1.00
R1880:Megf8 UTSW 7 25334860 missense possibly damaging 0.68
R1962:Megf8 UTSW 7 25363551 missense probably damaging 1.00
R2077:Megf8 UTSW 7 25353738 missense probably benign 0.15
R2127:Megf8 UTSW 7 25364582 missense possibly damaging 0.73
R2129:Megf8 UTSW 7 25330715 missense probably damaging 0.98
R2199:Megf8 UTSW 7 25339614 missense possibly damaging 0.87
R2201:Megf8 UTSW 7 25340745 missense probably damaging 1.00
R2205:Megf8 UTSW 7 25341748 missense probably benign 0.13
R2207:Megf8 UTSW 7 25349797 missense probably damaging 0.97
R2361:Megf8 UTSW 7 25348954 missense possibly damaging 0.94
R2680:Megf8 UTSW 7 25317556 missense probably benign 0.01
R3084:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3085:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3086:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3433:Megf8 UTSW 7 25360124 missense probably benign 0.00
R3939:Megf8 UTSW 7 25359202 missense probably benign 0.07
R4022:Megf8 UTSW 7 25337775 missense probably damaging 1.00
R4214:Megf8 UTSW 7 25355368 missense probably benign 0.03
R4357:Megf8 UTSW 7 25355749 missense probably benign 0.02
R4521:Megf8 UTSW 7 25342701 missense probably benign 0.19
R4620:Megf8 UTSW 7 25355098 missense possibly damaging 0.92
R4700:Megf8 UTSW 7 25363515 missense probably damaging 1.00
R4916:Megf8 UTSW 7 25339664 missense probably benign 0.24
R4940:Megf8 UTSW 7 25360706 missense probably damaging 1.00
R5048:Megf8 UTSW 7 25331092 missense possibly damaging 0.71
R5258:Megf8 UTSW 7 25348326 missense possibly damaging 0.88
R5271:Megf8 UTSW 7 25341706 missense probably damaging 1.00
R5390:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5391:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5708:Megf8 UTSW 7 25334597 missense probably benign 0.03
R5752:Megf8 UTSW 7 25355114 missense probably damaging 0.97
R5930:Megf8 UTSW 7 25326441 nonsense probably null
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6153:Megf8 UTSW 7 25347371 missense possibly damaging 0.93
R6210:Megf8 UTSW 7 25343720 missense possibly damaging 0.90
R6659:Megf8 UTSW 7 25358734 missense probably benign 0.38
R6867:Megf8 UTSW 7 25331035 missense probably benign 0.42
R6896:Megf8 UTSW 7 25329932 missense probably benign 0.00
R6899:Megf8 UTSW 7 25360713 missense probably damaging 1.00
R6905:Megf8 UTSW 7 25337932 missense probably benign 0.02
R7099:Megf8 UTSW 7 25346520 missense probably damaging 0.99
R7172:Megf8 UTSW 7 25343667 missense probably damaging 0.99
R7378:Megf8 UTSW 7 25348942 missense probably damaging 1.00
R7427:Megf8 UTSW 7 25338371 missense probably benign 0.44
R7492:Megf8 UTSW 7 25353848 missense probably benign 0.24
Z1088:Megf8 UTSW 7 25339669 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGTTTCCCTCTCAAACTGGG -3'
(R):5'- AAGGACAGACCGACTCCTTC -3'

Sequencing Primer
(F):5'- TCTCAAACTGGGAGAAGAGGG -3'
(R):5'- AGGAACTCAGTGGCCTCTAGTTAC -3'
Posted On2018-05-21