Incidental Mutation 'R6457:Uvrag'
ID516527
Institutional Source Beutler Lab
Gene Symbol Uvrag
Ensembl Gene ENSMUSG00000035354
Gene NameUV radiation resistance associated gene
Synonyms9530039D02Rik, Uvragl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6457 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location98885021-99141141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98906519 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 456 (F456S)
Ref Sequence ENSEMBL: ENSMUSP00000045297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037968]
Predicted Effect probably damaging
Transcript: ENSMUST00000037968
AA Change: F456S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045297
Gene: ENSMUSG00000035354
AA Change: F456S

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
C2 42 147 1.43e-2 SMART
Pfam:Atg14 183 469 4.9e-21 PFAM
low complexity region 546 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208609
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209090
Predicted Effect probably benign
Transcript: ENSMUST00000209123
Meta Mutation Damage Score 0.8858 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene complements the ultraviolet sensitivity of xeroderma pigmentosum group C cells and encodes a protein with a C2 domain. The protein activates the Beclin1-PI(3)KC3 complex, promoting autophagy and suppressing the proliferation and tumorigenicity of human colon cancer cells. Chromosomal aberrations involving this gene are associated with left-right axis malformation and mutations in this gene have been associated with colon cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transposon induced knock-out allele are viable and fertile but exhibit impaired autophagic flux, autophagosome accumulation in the heart, and age-related cardiomyopathy associated with compromised cardiac function and heart inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,622 V524E probably damaging Het
Acer2 T A 4: 86,900,571 M152K probably damaging Het
Actn3 T C 19: 4,871,848 D130G probably damaging Het
Ank1 T A 8: 23,087,967 F211Y probably damaging Het
Ankfn1 C T 11: 89,391,844 A326T probably benign Het
Ankrd11 G A 8: 122,908,764 R44C probably damaging Het
Ankrd46 A G 15: 36,484,071 probably benign Het
Aurkb G A 11: 69,048,346 E132K possibly damaging Het
Bsdc1 C T 4: 129,465,276 T9I possibly damaging Het
Card14 C T 11: 119,339,602 R767* probably null Het
Ccdc82 T A 9: 13,272,426 F411L possibly damaging Het
Col12a1 C T 9: 79,645,691 G2106D probably damaging Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cox10 A G 11: 63,964,372 L361P probably damaging Het
Cox18 A G 5: 90,223,689 I84T probably benign Het
Dhrs3 T C 4: 144,919,952 S125P probably damaging Het
Fbxl15 A G 19: 46,329,326 H149R probably benign Het
Flg2 T A 3: 93,220,482 S2234T unknown Het
Gtf2e1 A C 16: 37,536,336 probably null Het
H2-Q7 A T 17: 35,439,679 S98C probably damaging Het
Hcn2 G T 10: 79,733,773 E536* probably null Het
Kat6b A T 14: 21,670,680 H1700L probably damaging Het
Klhl3 C T 13: 58,100,378 V35I probably benign Het
Krt34 A T 11: 100,040,090 L162Q probably damaging Het
Ly9 A G 1: 171,589,095 S644P probably damaging Het
Magi1 A T 6: 93,699,639 V685E probably damaging Het
Malrd1 A G 2: 15,526,597 probably benign Het
Malrd1 A T 2: 15,667,929 H599L probably benign Het
Matn2 T A 15: 34,426,234 C631S probably damaging Het
Megf8 A T 7: 25,349,695 D1739V probably damaging Het
Mlf1 G A 3: 67,392,944 R98Q probably benign Het
Mprip T A 11: 59,758,989 I1173K possibly damaging Het
Mrc1 A G 2: 14,270,205 D439G probably damaging Het
Mroh5 A T 15: 73,790,842 W208R probably damaging Het
Ms4a5 T G 19: 11,279,282 I84L probably benign Het
Myt1 G A 2: 181,763,425 probably null Het
Nbea T A 3: 56,000,569 H1374L probably damaging Het
Nbeal1 T A 1: 60,253,474 I1095K probably benign Het
Nolc1 A G 19: 46,083,070 probably benign Het
Nr5a2 A G 1: 136,960,238 L18P probably benign Het
Nup188 G T 2: 30,322,187 C562F probably damaging Het
Obscn A G 11: 59,080,771 V2415A probably damaging Het
Pacsin2 A T 15: 83,379,678 probably null Het
Pias3 A G 3: 96,699,523 H34R possibly damaging Het
Ppfia2 T C 10: 106,893,500 V903A probably damaging Het
Pramel1 T A 4: 143,396,705 L84Q probably damaging Het
Pramel6 G A 2: 87,509,438 C182Y probably damaging Het
Prdm4 A G 10: 85,908,032 Y120H probably damaging Het
Prss28 A G 17: 25,311,357 M212V probably benign Het
Rbp3 G T 14: 33,955,267 G391* probably null Het
Rc3h2 C T 2: 37,411,139 probably null Het
Ret A G 6: 118,173,621 F645L probably benign Het
Sgsm2 A G 11: 74,865,169 S402P possibly damaging Het
Shc3 T A 13: 51,482,879 probably null Het
Slc25a16 A G 10: 62,941,159 N246S probably benign Het
Snrpd1 T A 18: 10,623,694 H26Q probably benign Het
Tex45 T C 8: 3,479,268 L251P probably damaging Het
Thsd1 A G 8: 22,243,347 T137A probably damaging Het
Tnik A T 3: 28,539,448 H151L probably damaging Het
Tns1 T A 1: 73,918,050 K1725N probably damaging Het
Tomm40l T A 1: 171,220,592 T147S probably damaging Het
Tomm6 G T 17: 47,688,007 probably benign Het
Trp53 G A 11: 69,589,614 C272Y probably damaging Het
Trpm7 A T 2: 126,807,294 V1492E probably benign Het
Tsen2 G A 6: 115,559,631 R116H probably benign Het
Vmn1r86 A T 7: 13,102,352 M199K possibly damaging Het
Vmn2r4 C T 3: 64,409,957 C120Y probably damaging Het
Other mutations in Uvrag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Uvrag APN 7 98979741 missense probably damaging 0.99
IGL01085:Uvrag APN 7 99118224 missense probably damaging 1.00
IGL01362:Uvrag APN 7 98888513 missense probably benign 0.03
IGL01510:Uvrag APN 7 99004589 nonsense probably null
IGL02016:Uvrag APN 7 99099442 missense probably benign 0.06
IGL02164:Uvrag APN 7 99004689 nonsense probably null
IGL02170:Uvrag APN 7 99109090 nonsense probably null
IGL02836:Uvrag APN 7 98979777 missense possibly damaging 0.83
IGL02963:Uvrag APN 7 98906490 critical splice donor site probably null
PIT4651001:Uvrag UTSW 7 98906520 missense probably benign 0.23
R0016:Uvrag UTSW 7 98991981 missense probably benign 0.01
R0016:Uvrag UTSW 7 98991981 missense probably benign 0.01
R0304:Uvrag UTSW 7 98887973 missense probably benign 0.03
R0394:Uvrag UTSW 7 99004719 splice site probably benign
R0561:Uvrag UTSW 7 98888561 missense probably damaging 0.96
R1398:Uvrag UTSW 7 99065820 nonsense probably null
R1646:Uvrag UTSW 7 99118224 missense probably damaging 1.00
R1692:Uvrag UTSW 7 99004663 missense probably benign 0.02
R1760:Uvrag UTSW 7 98888348 missense probably benign 0.03
R1767:Uvrag UTSW 7 99099394 missense probably damaging 0.98
R2011:Uvrag UTSW 7 98939889 critical splice donor site probably null
R2484:Uvrag UTSW 7 98888461 missense probably benign 0.00
R3684:Uvrag UTSW 7 98988220 missense probably damaging 1.00
R3698:Uvrag UTSW 7 98939943 missense probably damaging 1.00
R3766:Uvrag UTSW 7 98888143 nonsense probably null
R3810:Uvrag UTSW 7 98979712 missense probably damaging 1.00
R4703:Uvrag UTSW 7 98989587 missense probably damaging 1.00
R5853:Uvrag UTSW 7 98888077 missense possibly damaging 0.80
R5896:Uvrag UTSW 7 98988207 nonsense probably null
R6185:Uvrag UTSW 7 99140832 critical splice donor site probably null
R6248:Uvrag UTSW 7 98988191 missense probably damaging 0.99
R6812:Uvrag UTSW 7 98888482 missense probably benign
R7451:Uvrag UTSW 7 99140913 missense unknown
R7724:Uvrag UTSW 7 98991963 missense probably benign 0.06
R7769:Uvrag UTSW 7 98979721 missense probably damaging 0.98
R8094:Uvrag UTSW 7 98991967 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TAGCCAGAGCAGAGGTTACG -3'
(R):5'- CCATTAAATGCTGTGCCTCG -3'

Sequencing Primer
(F):5'- CCAGAGCAGAGGTTACGTTACAC -3'
(R):5'- GCTGTGCCTCGGCTGTAG -3'
Posted On2018-05-21