Incidental Mutation 'R6466:Rp1'
ID 516560
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Name retinitis pigmentosa 1 (human)
Synonyms Dcdc3, Orp1, mG145, Rp1h, oxygen-regulated protein 1
MMRRC Submission 044599-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R6466 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 4185896-4479508 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4418109 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1001 (Y1001C)
Ref Sequence ENSEMBL: ENSMUSP00000027032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]
AlphaFold P56716
Predicted Effect probably benign
Transcript: ENSMUST00000027032
AA Change: Y1001C

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: Y1001C

DomainStartEndE-ValueType
DCX 30 117 4.37e-39 SMART
low complexity region 120 133 N/A INTRINSIC
DCX 152 236 7.17e-35 SMART
low complexity region 343 354 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 646 661 N/A INTRINSIC
low complexity region 1113 1123 N/A INTRINSIC
low complexity region 1396 1412 N/A INTRINSIC
low complexity region 1434 1444 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194992
SMART Domains Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

DomainStartEndE-ValueType
DCX 40 127 4.37e-39 SMART
low complexity region 130 143 N/A INTRINSIC
DCX 162 246 7.17e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208793
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik A T 8: 121,335,735 (GRCm39) D69E probably damaging Het
AAdacl4fm3 T A 4: 144,430,437 (GRCm39) D184V probably damaging Het
Adgrv1 G T 13: 81,723,220 (GRCm39) probably null Het
Ahr A T 12: 35,554,031 (GRCm39) V696E probably benign Het
Akap13 A G 7: 75,376,792 (GRCm39) T2007A probably benign Het
Arid1b T C 17: 5,377,953 (GRCm39) F753S probably damaging Het
Bpifb3 G T 2: 153,764,108 (GRCm39) K105N probably damaging Het
C2cd2 A G 16: 97,680,822 (GRCm39) C331R probably benign Het
Chrm1 T A 19: 8,655,542 (GRCm39) Y82* probably null Het
Clcn3 A C 8: 61,382,595 (GRCm39) V331G probably damaging Het
Dchs1 A T 7: 105,413,748 (GRCm39) D1022E probably benign Het
Dnah2 T A 11: 69,430,241 (GRCm39) T106S probably benign Het
Fam171a2 T A 11: 102,330,711 (GRCm39) D256V probably damaging Het
Firrm G T 1: 163,781,734 (GRCm39) R898S probably benign Het
Fmn2 T A 1: 174,437,149 (GRCm39) probably benign Het
Fut11 C T 14: 20,745,377 (GRCm39) R103W probably damaging Het
Gas2l2 A C 11: 83,320,179 (GRCm39) S26A probably damaging Het
Gramd1a A T 7: 30,843,221 (GRCm39) I29N probably benign Het
Grem2 A G 1: 174,664,450 (GRCm39) V133A probably damaging Het
Hydin T A 8: 111,233,600 (GRCm39) S1813T possibly damaging Het
Igkv3-2 T C 6: 70,676,023 (GRCm39) F111L probably benign Het
Ints8 T C 4: 11,252,878 (GRCm39) Q68R probably damaging Het
Irx5 A G 8: 93,086,354 (GRCm39) I146V probably damaging Het
Kcnh3 T C 15: 99,136,124 (GRCm39) L707P probably damaging Het
Kcnk4 T A 19: 6,905,665 (GRCm39) I101F probably damaging Het
Klhl9 A G 4: 88,639,399 (GRCm39) Y281H probably benign Het
Klra9 G T 6: 130,155,995 (GRCm39) Y253* probably null Het
Lmbr1 C T 5: 29,583,166 (GRCm39) A9T probably benign Het
Map10 G T 8: 126,399,123 (GRCm39) E839* probably null Het
Nectin4 C A 1: 171,214,321 (GRCm39) A492D probably damaging Het
Nfat5 T A 8: 108,082,140 (GRCm39) probably null Het
Or5p5 A G 7: 107,413,901 (GRCm39) T37A probably benign Het
Plec A G 15: 76,062,084 (GRCm39) Y2608H probably benign Het
Pold3 A G 7: 99,749,839 (GRCm39) S42P probably benign Het
Ppp2r1a G T 17: 21,180,893 (GRCm39) G432* probably null Het
Qki T C 17: 10,434,394 (GRCm39) E315G probably benign Het
Rfx2 C T 17: 57,091,397 (GRCm39) V354I probably benign Het
Sez6l A G 5: 112,609,007 (GRCm39) probably null Het
Slc39a14 A G 14: 70,547,335 (GRCm39) I337T probably damaging Het
Slc3a2 G T 19: 8,686,683 (GRCm39) L76M probably damaging Het
Slco1a5 T C 6: 142,183,260 (GRCm39) T555A probably benign Het
Sprr2e A T 3: 92,260,341 (GRCm39) K57N unknown Het
Syne2 A G 12: 75,990,675 (GRCm39) T1886A probably damaging Het
Tenm3 A T 8: 48,689,098 (GRCm39) I2147N probably damaging Het
Thbs1 G T 2: 117,950,328 (GRCm39) G654W probably damaging Het
Tigd5 A G 15: 75,782,352 (GRCm39) Y238C possibly damaging Het
Tmem221 A G 8: 72,010,493 (GRCm39) F126S probably damaging Het
Trp63 C A 16: 25,582,108 (GRCm39) P52Q probably damaging Het
Ugp2 A T 11: 21,278,883 (GRCm39) S434R probably benign Het
Vmn2r69 A C 7: 85,056,378 (GRCm39) F587V probably benign Het
Vps13d T A 4: 144,784,065 (GRCm39) N3872I possibly damaging Het
Wdfy2 A G 14: 63,186,115 (GRCm39) Y250C probably damaging Het
Zbtb16 T C 9: 48,576,619 (GRCm39) D487G possibly damaging Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4,416,969 (GRCm39) missense probably damaging 0.98
IGL00593:Rp1 APN 1 4,415,626 (GRCm39) missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4,422,435 (GRCm39) missense probably damaging 1.00
IGL01070:Rp1 APN 1 4,415,461 (GRCm39) missense probably damaging 1.00
IGL01531:Rp1 APN 1 4,419,168 (GRCm39) missense probably benign 0.00
IGL01668:Rp1 APN 1 4,415,941 (GRCm39) missense probably damaging 1.00
IGL01907:Rp1 APN 1 4,418,730 (GRCm39) missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4,422,745 (GRCm39) missense probably damaging 1.00
IGL02071:Rp1 APN 1 4,415,533 (GRCm39) missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4,417,608 (GRCm39) missense probably damaging 0.99
IGL02244:Rp1 APN 1 4,419,003 (GRCm39) missense probably benign 0.00
IGL02381:Rp1 APN 1 4,422,613 (GRCm39) missense probably benign 0.01
IGL02499:Rp1 APN 1 4,419,271 (GRCm39) missense probably benign 0.17
IGL02619:Rp1 APN 1 4,418,673 (GRCm39) missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4,419,936 (GRCm39) missense probably benign 0.03
IGL02861:Rp1 APN 1 4,416,375 (GRCm39) nonsense probably null
IGL03288:Rp1 APN 1 4,419,747 (GRCm39) missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4,420,264 (GRCm39) missense probably damaging 1.00
IGL03303:Rp1 APN 1 4,415,040 (GRCm39) missense probably damaging 1.00
R0041:Rp1 UTSW 1 4,414,851 (GRCm39) missense probably benign 0.36
R0111:Rp1 UTSW 1 4,414,983 (GRCm39) missense probably damaging 1.00
R0363:Rp1 UTSW 1 4,417,941 (GRCm39) missense probably damaging 1.00
R0440:Rp1 UTSW 1 4,415,863 (GRCm39) missense probably damaging 1.00
R0442:Rp1 UTSW 1 4,416,970 (GRCm39) missense probably benign 0.09
R0528:Rp1 UTSW 1 4,415,088 (GRCm39) missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4,418,060 (GRCm39) missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4,416,721 (GRCm39) missense probably benign 0.00
R0856:Rp1 UTSW 1 4,414,878 (GRCm39) missense probably benign 0.05
R0908:Rp1 UTSW 1 4,414,878 (GRCm39) missense probably benign 0.05
R0968:Rp1 UTSW 1 4,415,575 (GRCm39) missense probably benign 0.00
R1099:Rp1 UTSW 1 4,422,513 (GRCm39) missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4,415,185 (GRCm39) missense probably benign 0.03
R1301:Rp1 UTSW 1 4,416,159 (GRCm39) missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4,418,193 (GRCm39) missense probably benign 0.01
R1403:Rp1 UTSW 1 4,416,520 (GRCm39) missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4,416,520 (GRCm39) missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4,422,144 (GRCm39) missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4,422,144 (GRCm39) missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4,417,619 (GRCm39) missense probably damaging 1.00
R1509:Rp1 UTSW 1 4,418,760 (GRCm39) missense probably benign 0.20
R1509:Rp1 UTSW 1 4,417,917 (GRCm39) missense probably damaging 0.98
R1538:Rp1 UTSW 1 4,415,899 (GRCm39) missense probably damaging 1.00
R1609:Rp1 UTSW 1 4,419,424 (GRCm39) missense probably damaging 1.00
R1666:Rp1 UTSW 1 4,420,086 (GRCm39) missense probably damaging 1.00
R1703:Rp1 UTSW 1 4,415,392 (GRCm39) missense probably damaging 1.00
R1782:Rp1 UTSW 1 4,419,312 (GRCm39) missense probably benign 0.00
R1799:Rp1 UTSW 1 4,419,055 (GRCm39) missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4,417,455 (GRCm39) missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4,418,943 (GRCm39) missense probably damaging 0.99
R1919:Rp1 UTSW 1 4,422,894 (GRCm39) missense probably damaging 0.99
R2087:Rp1 UTSW 1 4,418,575 (GRCm39) missense probably damaging 1.00
R2211:Rp1 UTSW 1 4,418,362 (GRCm39) missense probably damaging 0.96
R2278:Rp1 UTSW 1 4,418,250 (GRCm39) missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4,416,182 (GRCm39) nonsense probably null
R2316:Rp1 UTSW 1 4,415,863 (GRCm39) missense probably damaging 1.00
R2346:Rp1 UTSW 1 4,418,236 (GRCm39) missense probably damaging 1.00
R2878:Rp1 UTSW 1 4,418,362 (GRCm39) missense probably damaging 1.00
R3023:Rp1 UTSW 1 4,422,898 (GRCm39) missense probably damaging 1.00
R3025:Rp1 UTSW 1 4,422,898 (GRCm39) missense probably damaging 1.00
R3716:Rp1 UTSW 1 4,419,988 (GRCm39) missense probably benign 0.38
R3814:Rp1 UTSW 1 4,419,931 (GRCm39) missense probably benign
R3929:Rp1 UTSW 1 4,422,868 (GRCm39) missense probably damaging 1.00
R4064:Rp1 UTSW 1 4,415,623 (GRCm39) missense probably benign 0.08
R4426:Rp1 UTSW 1 4,418,147 (GRCm39) missense probably benign 0.13
R4557:Rp1 UTSW 1 4,414,886 (GRCm39) missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4,416,101 (GRCm39) missense probably damaging 0.96
R4845:Rp1 UTSW 1 4,419,451 (GRCm39) missense probably benign 0.02
R4850:Rp1 UTSW 1 4,418,898 (GRCm39) missense probably damaging 1.00
R4857:Rp1 UTSW 1 4,422,540 (GRCm39) missense probably damaging 1.00
R4857:Rp1 UTSW 1 4,422,539 (GRCm39) missense probably damaging 0.99
R5159:Rp1 UTSW 1 4,416,426 (GRCm39) missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4,418,256 (GRCm39) missense probably benign 0.01
R5327:Rp1 UTSW 1 4,419,583 (GRCm39) splice site probably null
R5352:Rp1 UTSW 1 4,417,321 (GRCm39) missense probably benign 0.00
R5504:Rp1 UTSW 1 4,420,113 (GRCm39) missense probably damaging 1.00
R5527:Rp1 UTSW 1 4,416,616 (GRCm39) missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4,416,055 (GRCm39) missense probably benign 0.42
R5569:Rp1 UTSW 1 4,415,460 (GRCm39) missense probably damaging 1.00
R5622:Rp1 UTSW 1 4,418,060 (GRCm39) missense possibly damaging 0.76
R5970:Rp1 UTSW 1 4,418,685 (GRCm39) missense probably benign 0.05
R5992:Rp1 UTSW 1 4,218,926 (GRCm39) missense unknown
R6004:Rp1 UTSW 1 4,267,808 (GRCm39) missense unknown
R6018:Rp1 UTSW 1 4,423,059 (GRCm39) missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4,415,602 (GRCm39) missense probably benign 0.02
R6127:Rp1 UTSW 1 4,419,534 (GRCm39) missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4,420,092 (GRCm39) missense probably damaging 1.00
R6301:Rp1 UTSW 1 4,417,477 (GRCm39) missense probably benign 0.04
R6317:Rp1 UTSW 1 4,112,212 (GRCm39) missense unknown
R6405:Rp1 UTSW 1 4,415,994 (GRCm39) missense probably damaging 1.00
R6445:Rp1 UTSW 1 4,296,840 (GRCm39) missense unknown
R6501:Rp1 UTSW 1 4,381,503 (GRCm39) intron probably benign
R6547:Rp1 UTSW 1 4,240,528 (GRCm39) missense unknown
R6604:Rp1 UTSW 1 4,089,351 (GRCm39) missense unknown
R6700:Rp1 UTSW 1 4,420,119 (GRCm39) missense probably damaging 1.00
R6706:Rp1 UTSW 1 4,212,887 (GRCm39) missense unknown
R6831:Rp1 UTSW 1 4,420,087 (GRCm39) splice site probably null
R6918:Rp1 UTSW 1 4,069,831 (GRCm39) missense unknown
R6973:Rp1 UTSW 1 4,422,217 (GRCm39) nonsense probably null
R6981:Rp1 UTSW 1 4,415,878 (GRCm39) missense probably benign 0.06
R7009:Rp1 UTSW 1 4,112,291 (GRCm39) missense unknown
R7078:Rp1 UTSW 1 4,277,014 (GRCm39) missense unknown
R7112:Rp1 UTSW 1 4,419,241 (GRCm39) missense probably benign 0.43
R7135:Rp1 UTSW 1 4,418,391 (GRCm39) missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4,420,140 (GRCm39) missense probably damaging 0.99
R7199:Rp1 UTSW 1 4,417,513 (GRCm39) missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4,298,824 (GRCm39) missense unknown
R7367:Rp1 UTSW 1 4,418,221 (GRCm39) missense probably benign 0.42
R7484:Rp1 UTSW 1 4,415,704 (GRCm39) missense probably benign 0.10
R7500:Rp1 UTSW 1 4,381,501 (GRCm39) missense unknown
R7569:Rp1 UTSW 1 4,355,063 (GRCm39) missense unknown
R7642:Rp1 UTSW 1 4,218,054 (GRCm39) missense unknown
R7693:Rp1 UTSW 1 4,417,626 (GRCm39) missense probably damaging 1.00
R7742:Rp1 UTSW 1 4,240,457 (GRCm39) missense unknown
R7759:Rp1 UTSW 1 4,415,107 (GRCm39) missense probably benign
R7784:Rp1 UTSW 1 4,212,881 (GRCm39) missense unknown
R7816:Rp1 UTSW 1 4,417,926 (GRCm39) missense probably damaging 0.98
R7866:Rp1 UTSW 1 4,417,924 (GRCm39) missense probably benign 0.02
R8215:Rp1 UTSW 1 4,315,318 (GRCm39) missense unknown
R8281:Rp1 UTSW 1 4,418,139 (GRCm39) missense probably damaging 1.00
R8294:Rp1 UTSW 1 4,416,220 (GRCm39) missense probably benign 0.09
R8309:Rp1 UTSW 1 4,417,312 (GRCm39) missense probably benign 0.00
R8311:Rp1 UTSW 1 4,418,572 (GRCm39) missense probably benign 0.11
R8500:Rp1 UTSW 1 4,416,813 (GRCm39) missense possibly damaging 0.91
R8559:Rp1 UTSW 1 4,419,784 (GRCm39) missense probably damaging 1.00
R8672:Rp1 UTSW 1 4,419,007 (GRCm39) missense possibly damaging 0.55
R8688:Rp1 UTSW 1 4,416,628 (GRCm39) missense probably benign 0.01
R8792:Rp1 UTSW 1 4,095,091 (GRCm39) missense unknown
R8859:Rp1 UTSW 1 4,420,183 (GRCm39) missense probably benign 0.07
R8945:Rp1 UTSW 1 4,419,817 (GRCm39) missense probably benign 0.42
R8959:Rp1 UTSW 1 4,419,650 (GRCm39) intron probably benign
R8979:Rp1 UTSW 1 4,218,937 (GRCm39) missense unknown
R9126:Rp1 UTSW 1 4,417,136 (GRCm39) missense probably damaging 0.99
R9156:Rp1 UTSW 1 4,234,161 (GRCm39) missense unknown
R9160:Rp1 UTSW 1 4,416,720 (GRCm39) missense probably benign 0.00
R9221:Rp1 UTSW 1 4,315,266 (GRCm39) missense unknown
R9263:Rp1 UTSW 1 4,419,160 (GRCm39) missense probably benign 0.02
R9263:Rp1 UTSW 1 4,418,675 (GRCm39) missense probably benign 0.25
R9302:Rp1 UTSW 1 4,416,789 (GRCm39) missense probably damaging 1.00
R9318:Rp1 UTSW 1 4,418,488 (GRCm39) missense probably benign 0.09
R9414:Rp1 UTSW 1 4,313,841 (GRCm39) missense unknown
R9474:Rp1 UTSW 1 4,162,838 (GRCm39) critical splice donor site probably null
R9478:Rp1 UTSW 1 4,417,545 (GRCm39) missense probably benign 0.06
R9529:Rp1 UTSW 1 4,416,447 (GRCm39) missense probably benign
R9572:Rp1 UTSW 1 4,418,662 (GRCm39) missense probably benign
R9673:Rp1 UTSW 1 4,337,792 (GRCm39) missense unknown
R9709:Rp1 UTSW 1 4,112,255 (GRCm39) missense unknown
R9716:Rp1 UTSW 1 4,212,833 (GRCm39) critical splice donor site probably null
RF003:Rp1 UTSW 1 4,414,917 (GRCm39) missense probably damaging 0.99
V1662:Rp1 UTSW 1 4,419,783 (GRCm39) missense probably damaging 1.00
X0012:Rp1 UTSW 1 4,417,918 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCTGGTAAGTAGTCTTTTAGAAC -3'
(R):5'- AACCGCAATGGCTTTCTAGG -3'

Sequencing Primer
(F):5'- TTCTCCCATAGTATCTACCTGAATGG -3'
(R):5'- CCGCAATGGCTTTCTAGGAAATAATC -3'
Posted On 2018-05-21