Incidental Mutation 'R6466:Fmn2'
ID516564
Institutional Source Beutler Lab
Gene Symbol Fmn2
Ensembl Gene ENSMUSG00000028354
Gene Nameformin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R6466 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location174501825-174822729 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 174609583 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030039]
Predicted Effect unknown
Transcript: ENSMUST00000030039
AA Change: V1040E
SMART Domains Protein: ENSMUSP00000030039
Gene: ENSMUSG00000028354
AA Change: V1040E

DomainStartEndE-ValueType
low complexity region 35 69 N/A INTRINSIC
low complexity region 196 212 N/A INTRINSIC
low complexity region 304 334 N/A INTRINSIC
Blast:FH2 353 577 2e-97 BLAST
low complexity region 604 616 N/A INTRINSIC
coiled coil region 645 681 N/A INTRINSIC
Blast:FH2 710 788 2e-14 BLAST
low complexity region 796 831 N/A INTRINSIC
Pfam:Drf_FH1 942 1048 3.1e-16 PFAM
low complexity region 1117 1131 N/A INTRINSIC
FH2 1139 1543 1.29e-85 SMART
PDB:2YLE|B 1550 1578 4e-11 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195300
Predicted Effect probably benign
Transcript: ENSMUST00000195621
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the formin homology protein family. The encoded protein is thought to have essential roles in organization of the actin cytoskeleton and in cell polarity. Mutations in this gene have been associated with mental retardation autosomal recessive 47 (MRT47). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Female mice homozygous for a knock-out allele display polyploid embryo formation, recurrent pregnancy loss, hypofertility, and inadequate nursing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik A T 8: 120,608,996 D69E probably damaging Het
Adgrv1 G T 13: 81,575,101 probably null Het
Ahr A T 12: 35,504,032 V696E probably benign Het
Akap13 A G 7: 75,727,044 T2007A probably benign Het
Arid1b T C 17: 5,327,678 F753S probably damaging Het
BC055324 G T 1: 163,954,165 R898S probably benign Het
Bpifb3 G T 2: 153,922,188 K105N probably damaging Het
C2cd2 A G 16: 97,879,622 C331R probably benign Het
Chrm1 T A 19: 8,678,178 Y82* probably null Het
Clcn3 A C 8: 60,929,561 V331G probably damaging Het
Dchs1 A T 7: 105,764,541 D1022E probably benign Het
Dnah2 T A 11: 69,539,415 T106S probably benign Het
Fam171a2 T A 11: 102,439,885 D256V probably damaging Het
Fut11 C T 14: 20,695,309 R103W probably damaging Het
Gas2l2 A C 11: 83,429,353 S26A probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gramd1a A T 7: 31,143,796 I29N probably benign Het
Grem2 A G 1: 174,836,884 V133A probably damaging Het
Hydin T A 8: 110,506,968 S1813T possibly damaging Het
Igkv3-2 T C 6: 70,699,039 F111L probably benign Het
Ints8 T C 4: 11,252,878 Q68R probably damaging Het
Irx5 A G 8: 92,359,726 I146V probably damaging Het
Kcnh3 T C 15: 99,238,243 L707P probably damaging Het
Kcnk4 T A 19: 6,928,297 I101F probably damaging Het
Klhl9 A G 4: 88,721,162 Y281H probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lmbr1 C T 5: 29,378,168 A9T probably benign Het
Map10 G T 8: 125,672,384 E839* probably null Het
Nectin4 C A 1: 171,386,753 A492D probably damaging Het
Nfat5 T A 8: 107,355,508 probably null Het
Olfr467 A G 7: 107,814,694 T37A probably benign Het
Plec A G 15: 76,177,884 Y2608H probably benign Het
Pold3 A G 7: 100,100,632 S42P probably benign Het
Ppp2r1a G T 17: 20,960,631 G432* probably null Het
Qk T C 17: 10,215,465 E315G probably benign Het
Rfx2 C T 17: 56,784,397 V354I probably benign Het
Rp1 T C 1: 4,347,886 Y1001C probably benign Het
Sez6l A G 5: 112,461,141 probably null Het
Slc39a14 A G 14: 70,309,886 I337T probably damaging Het
Slc3a2 G T 19: 8,709,319 L76M probably damaging Het
Slco1a5 T C 6: 142,237,534 T555A probably benign Het
Sprr2e A T 3: 92,353,034 K57N unknown Het
Syne2 A G 12: 75,943,901 T1886A probably damaging Het
Tenm3 A T 8: 48,236,063 I2147N probably damaging Het
Thbs1 G T 2: 118,119,847 G654W probably damaging Het
Tigd5 A G 15: 75,910,503 Y238C possibly damaging Het
Tmem221 A G 8: 71,557,849 F126S probably damaging Het
Trp63 C A 16: 25,763,358 P52Q probably damaging Het
Ugp2 A T 11: 21,328,883 S434R probably benign Het
Vmn2r69 A C 7: 85,407,170 F587V probably benign Het
Vps13d T A 4: 145,057,495 N3872I possibly damaging Het
Wdfy2 A G 14: 62,948,666 Y250C probably damaging Het
Zbtb16 T C 9: 48,665,319 D487G possibly damaging Het
Other mutations in Fmn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fmn2 APN 1 174503319 missense unknown
IGL01085:Fmn2 APN 1 174695654 missense probably damaging 1.00
IGL01784:Fmn2 APN 1 174502428 missense unknown
IGL02095:Fmn2 APN 1 174502601 missense unknown
IGL02330:Fmn2 APN 1 174609945 missense probably benign 0.38
IGL02552:Fmn2 APN 1 174695720 missense probably damaging 1.00
IGL02835:Fmn2 UTSW 1 174582059 missense unknown
PIT4498001:Fmn2 UTSW 1 174612604 missense probably damaging 1.00
PIT4677001:Fmn2 UTSW 1 174647133 missense probably damaging 1.00
R0025:Fmn2 UTSW 1 174791314 missense probably damaging 1.00
R0062:Fmn2 UTSW 1 174608449 unclassified probably benign
R0062:Fmn2 UTSW 1 174608449 unclassified probably benign
R0306:Fmn2 UTSW 1 174609484 unclassified probably benign
R0325:Fmn2 UTSW 1 174609954 critical splice donor site probably null
R0403:Fmn2 UTSW 1 174694278 missense probably damaging 1.00
R0491:Fmn2 UTSW 1 174581959 missense unknown
R0898:Fmn2 UTSW 1 174503460 missense unknown
R1202:Fmn2 UTSW 1 174612535 nonsense probably null
R1719:Fmn2 UTSW 1 174608458 unclassified probably benign
R1763:Fmn2 UTSW 1 174502266 missense unknown
R1771:Fmn2 UTSW 1 174608776 unclassified probably benign
R1777:Fmn2 UTSW 1 174581922 missense unknown
R1831:Fmn2 UTSW 1 174609945 missense probably benign 0.38
R2259:Fmn2 UTSW 1 174502932 missense unknown
R2960:Fmn2 UTSW 1 174609819 missense probably damaging 1.00
R3545:Fmn2 UTSW 1 174502626 missense unknown
R3840:Fmn2 UTSW 1 174582033 frame shift probably null
R4207:Fmn2 UTSW 1 174581955 missense unknown
R4679:Fmn2 UTSW 1 174503162 missense unknown
R4779:Fmn2 UTSW 1 174609895 missense probably damaging 1.00
R4887:Fmn2 UTSW 1 174581961 missense unknown
R4926:Fmn2 UTSW 1 174502415 missense unknown
R5007:Fmn2 UTSW 1 174744300 missense probably damaging 1.00
R5247:Fmn2 UTSW 1 174821228 missense probably benign 0.04
R5324:Fmn2 UTSW 1 174608880 unclassified probably benign
R5353:Fmn2 UTSW 1 174503006 missense unknown
R5420:Fmn2 UTSW 1 174698778 nonsense probably null
R5607:Fmn2 UTSW 1 174609811 missense probably damaging 0.97
R5668:Fmn2 UTSW 1 174582037 missense unknown
R5982:Fmn2 UTSW 1 174502453 missense unknown
R6148:Fmn2 UTSW 1 174666663 missense probably damaging 1.00
R6324:Fmn2 UTSW 1 174612553 missense possibly damaging 0.87
R6647:Fmn2 UTSW 1 174593104 missense unknown
R6835:Fmn2 UTSW 1 174699669 missense probably damaging 1.00
R7231:Fmn2 UTSW 1 174609203 unclassified probably benign
R7340:Fmn2 UTSW 1 174609203 unclassified probably benign
R7378:Fmn2 UTSW 1 174609203 unclassified probably benign
R7457:Fmn2 UTSW 1 174503737 intron probably null
R7474:Fmn2 UTSW 1 174609203 unclassified probably benign
R7564:Fmn2 UTSW 1 174609574 missense unknown
R7582:Fmn2 UTSW 1 174698790 missense probably damaging 1.00
R7748:Fmn2 UTSW 1 174666649 missense probably damaging 1.00
R7832:Fmn2 UTSW 1 174609203 unclassified probably benign
R8035:Fmn2 UTSW 1 174719871 missense probably damaging 1.00
RF010:Fmn2 UTSW 1 174582015 missense unknown
Z1176:Fmn2 UTSW 1 174608394 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGAATGGGAATACCTCCTCC -3'
(R):5'- CTCCCAACTTGTGAGGAGTGTG -3'

Sequencing Primer
(F):5'- TCTACCTGGAGTGGGCATAC -3'
(R):5'- TGTGGAGGACCTGAGCCAG -3'
Posted On2018-05-21