Mutagenetix > Incidental Mutations

Incidental Mutation 'R6466:Ints8'

516569

Institutional Source

Beutler Lab

Gene Symbol

Ints8

Ensembl Gene

ENSMUSG00000040738

Gene Name

integrator complex subunit 8

Synonyms

2810013E07Rik, D130008D20Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001159595.1, NM_178112.5; MGI:1919906

Is this an essential gene?

Probably essential (E-score: 0.954) question?

Stock #

R6466 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11199158-11254258 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 11252878 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 68 (Q68R)

Ref Sequence

ENSEMBL: ENSMUSP00000103955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044616
AA Change: Q68R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: Q68R

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108318
AA Change: Q68R

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: Q68R

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC
SCOP:d1a17__	826	961	9e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108319
AA Change: Q68R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: Q68R

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.3%
20x: 91.1%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]

Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190005I06Rik	A	T	8: 120,608,996	D69E	probably damaging	Het
Adgrv1	G	T	13: 81,575,101		probably null	Het
Ahr	A	T	12: 35,504,032	V696E	probably benign	Het
Akap13	A	G	7: 75,727,044	T2007A	probably benign	Het
Arid1b	T	C	17: 5,327,678	F753S	probably damaging	Het
BC055324	G	T	1: 163,954,165	R898S	probably benign	Het
Bpifb3	G	T	2: 153,922,188	K105N	probably damaging	Het
C2cd2	A	G	16: 97,879,622	C331R	probably benign	Het
Chrm1	T	A	19: 8,678,178	Y82*	probably null	Het
Clcn3	A	C	8: 60,929,561	V331G	probably damaging	Het
Dchs1	A	T	7: 105,764,541	D1022E	probably benign	Het
Dnah2	T	A	11: 69,539,415	T106S	probably benign	Het
Fam171a2	T	A	11: 102,439,885	D256V	probably damaging	Het
Fmn2	T	A	1: 174,609,583		probably benign	Het
Fut11	C	T	14: 20,695,309	R103W	probably damaging	Het
Gas2l2	A	C	11: 83,429,353	S26A	probably damaging	Het
Gm13178	T	A	4: 144,703,867	D184V	probably damaging	Het
Gramd1a	A	T	7: 31,143,796	I29N	probably benign	Het
Grem2	A	G	1: 174,836,884	V133A	probably damaging	Het
Hydin	T	A	8: 110,506,968	S1813T	possibly damaging	Het
Igkv3-2	T	C	6: 70,699,039	F111L	probably benign	Het
Irx5	A	G	8: 92,359,726	I146V	probably damaging	Het
Kcnh3	T	C	15: 99,238,243	L707P	probably damaging	Het
Kcnk4	T	A	19: 6,928,297	I101F	probably damaging	Het
Klhl9	A	G	4: 88,721,162	Y281H	probably benign	Het
Klra9	G	T	6: 130,179,032	Y253*	probably null	Het
Lmbr1	C	T	5: 29,378,168	A9T	probably benign	Het
Map10	G	T	8: 125,672,384	E839*	probably null	Het
Nectin4	C	A	1: 171,386,753	A492D	probably damaging	Het
Nfat5	T	A	8: 107,355,508		probably null	Het
Olfr467	A	G	7: 107,814,694	T37A	probably benign	Het
Plec	A	G	15: 76,177,884	Y2608H	probably benign	Het
Pold3	A	G	7: 100,100,632	S42P	probably benign	Het
Ppp2r1a	G	T	17: 20,960,631	G432*	probably null	Het
Qk	T	C	17: 10,215,465	E315G	probably benign	Het
Rfx2	C	T	17: 56,784,397	V354I	probably benign	Het
Rp1	T	C	1: 4,347,886	Y1001C	probably benign	Het
Sez6l	A	G	5: 112,461,141		probably null	Het
Slc39a14	A	G	14: 70,309,886	I337T	probably damaging	Het
Slc3a2	G	T	19: 8,709,319	L76M	probably damaging	Het
Slco1a5	T	C	6: 142,237,534	T555A	probably benign	Het
Sprr2e	A	T	3: 92,353,034	K57N	unknown	Het
Syne2	A	G	12: 75,943,901	T1886A	probably damaging	Het
Tenm3	A	T	8: 48,236,063	I2147N	probably damaging	Het
Thbs1	G	T	2: 118,119,847	G654W	probably damaging	Het
Tigd5	A	G	15: 75,910,503	Y238C	possibly damaging	Het
Tmem221	A	G	8: 71,557,849	F126S	probably damaging	Het
Trp63	C	A	16: 25,763,358	P52Q	probably damaging	Het
Ugp2	A	T	11: 21,328,883	S434R	probably benign	Het
Vmn2r69	A	C	7: 85,407,170	F587V	probably benign	Het
Vps13d	T	A	4: 145,057,495	N3872I	possibly damaging	Het
Wdfy2	A	G	14: 62,948,666	Y250C	probably damaging	Het
Zbtb16	T	C	9: 48,665,319	D487G	possibly damaging	Het

Other mutations in Ints8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01390:Ints8	APN	4	11218679	splice site	probably benign
IGL01925:Ints8	APN	4	11235617	splice site	probably benign
IGL02195:Ints8	APN	4	11221222	missense	probably damaging	1.00
IGL02215:Ints8	APN	4	11209244	missense	probably damaging	1.00
IGL02429:Ints8	APN	4	11231720	missense	probably damaging	1.00
IGL02484:Ints8	APN	4	11208834	nonsense	probably null
IGL02558:Ints8	APN	4	11218771	missense	probably damaging	1.00
IGL02725:Ints8	APN	4	11239406	missense	probably benign	0.01
IGL02742:Ints8	APN	4	11241627	missense	possibly damaging	0.75
IGL02831:Ints8	APN	4	11245896	missense	possibly damaging	0.51
IGL03140:Ints8	APN	4	11235565	missense	probably damaging	1.00
IGL03171:Ints8	APN	4	11231702	missense	probably benign	0.01
IGL03335:Ints8	APN	4	11216460	missense	probably damaging	1.00
P0026:Ints8	UTSW	4	11225788	nonsense	probably null
R0054:Ints8	UTSW	4	11204595	utr 3 prime	probably benign
R0063:Ints8	UTSW	4	11252857	missense	probably damaging	1.00
R0063:Ints8	UTSW	4	11252857	missense	probably damaging	1.00
R0184:Ints8	UTSW	4	11218637	missense	probably benign	0.03
R0299:Ints8	UTSW	4	11246097	missense	probably benign	0.04
R0499:Ints8	UTSW	4	11246097	missense	probably benign	0.04
R0540:Ints8	UTSW	4	11252926	missense	possibly damaging	0.94
R0657:Ints8	UTSW	4	11246097	missense	probably benign	0.04
R1232:Ints8	UTSW	4	11234587	missense	possibly damaging	0.81
R1296:Ints8	UTSW	4	11221204	missense	possibly damaging	0.95
R1390:Ints8	UTSW	4	11239461	missense	probably benign	0.22
R1503:Ints8	UTSW	4	11245842	missense	probably damaging	0.97
R1587:Ints8	UTSW	4	11245722	critical splice donor site	probably null
R1701:Ints8	UTSW	4	11231656	missense	probably damaging	1.00
R1721:Ints8	UTSW	4	11241684	missense	probably damaging	0.97
R1757:Ints8	UTSW	4	11254109	start codon destroyed	probably null	0.99
R1777:Ints8	UTSW	4	11225600	critical splice donor site	probably null
R1867:Ints8	UTSW	4	11241684	missense	probably damaging	0.97
R1868:Ints8	UTSW	4	11241684	missense	probably damaging	0.97
R1952:Ints8	UTSW	4	11221150	missense	probably benign	0.21
R2084:Ints8	UTSW	4	11230377	missense	probably benign	0.31
R2108:Ints8	UTSW	4	11235552	missense	probably damaging	0.99
R2202:Ints8	UTSW	4	11225712	missense	possibly damaging	0.79
R2203:Ints8	UTSW	4	11225712	missense	possibly damaging	0.79
R2205:Ints8	UTSW	4	11225712	missense	possibly damaging	0.79
R2439:Ints8	UTSW	4	11225725	missense	probably benign	0.29
R2504:Ints8	UTSW	4	11241642	missense	probably benign	0.03
R3824:Ints8	UTSW	4	11225621	nonsense	probably null
R4664:Ints8	UTSW	4	11227152	missense	probably benign	0.04
R4703:Ints8	UTSW	4	11223785	missense	possibly damaging	0.92
R4895:Ints8	UTSW	4	11230367	nonsense	probably null
R5206:Ints8	UTSW	4	11216477	missense	possibly damaging	0.65
R5262:Ints8	UTSW	4	11211916	missense	probably damaging	1.00
R5505:Ints8	UTSW	4	11221143	missense	probably benign	0.18
R5513:Ints8	UTSW	4	11248303	missense	possibly damaging	0.79
R5750:Ints8	UTSW	4	11241654	missense	possibly damaging	0.81
R5892:Ints8	UTSW	4	11223813	missense	probably damaging	1.00
R6007:Ints8	UTSW	4	11208845	missense	possibly damaging	0.70
R6229:Ints8	UTSW	4	11252891	missense	probably damaging	1.00
R6709:Ints8	UTSW	4	11221117	missense	possibly damaging	0.65
R6986:Ints8	UTSW	4	11204474	missense	probably damaging	1.00
R6998:Ints8	UTSW	4	11204537	missense	possibly damaging	0.80
R7074:Ints8	UTSW	4	11204574	missense	possibly damaging	0.82
R7221:Ints8	UTSW	4	11225613	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTGCCATGAACATGCAGAAAAG -3'
(R):5'- ACCTCCAGATGTTTCGTGCC -3'

Sequencing Primer
(F):5'- TCAGAAAAACATTAGAATCCAGACAG -3'
(R):5'- CCCCCAAGTACCATAGTCTTTAG -3'

Posted On

2018-05-21