Incidental Mutation 'R6466:Klhl9'
ID516570
Institutional Source Beutler Lab
Gene Symbol Klhl9
Ensembl Gene ENSMUSG00000070923
Gene Namekelch-like 9
SynonymsC530050O22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6466 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location88718292-88722465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88721162 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 281 (Y281H)
Ref Sequence ENSEMBL: ENSMUSP00000092602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094993] [ENSMUST00000181601]
Predicted Effect probably benign
Transcript: ENSMUST00000094993
AA Change: Y281H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092602
Gene: ENSMUSG00000070923
AA Change: Y281H

DomainStartEndE-ValueType
BTB 50 149 7.21e-22 SMART
BACK 154 255 3.93e-27 SMART
low complexity region 276 287 N/A INTRINSIC
Kelch 299 347 1.13e-2 SMART
Kelch 348 399 1.92e-5 SMART
Kelch 400 446 1.59e-11 SMART
Kelch 447 493 2.61e-7 SMART
Kelch 494 545 1.58e-6 SMART
Kelch 546 594 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181601
SMART Domains Protein: ENSMUSP00000137773
Gene: ENSMUSG00000097078

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the kelch repeat-containing family, and contains an N-terminal BTB/POZ domain, a BACK domain and six C-terminal kelch repeats. The encoded protein is a component of a complex with cullin 3-based E3 ligase, which plays a role in mitosis. This protein complex is a cell cycle regulator, and functions in the organization and integrity of the spindle midzone in anaphase and the completion of cytokinesis. The complex is required for the removal of the chromosomal passenger protein aurora B from mitotic chromosomes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik A T 8: 120,608,996 D69E probably damaging Het
Adgrv1 G T 13: 81,575,101 probably null Het
Ahr A T 12: 35,504,032 V696E probably benign Het
Akap13 A G 7: 75,727,044 T2007A probably benign Het
Arid1b T C 17: 5,327,678 F753S probably damaging Het
BC055324 G T 1: 163,954,165 R898S probably benign Het
Bpifb3 G T 2: 153,922,188 K105N probably damaging Het
C2cd2 A G 16: 97,879,622 C331R probably benign Het
Chrm1 T A 19: 8,678,178 Y82* probably null Het
Clcn3 A C 8: 60,929,561 V331G probably damaging Het
Dchs1 A T 7: 105,764,541 D1022E probably benign Het
Dnah2 T A 11: 69,539,415 T106S probably benign Het
Fam171a2 T A 11: 102,439,885 D256V probably damaging Het
Fmn2 T A 1: 174,609,583 probably benign Het
Fut11 C T 14: 20,695,309 R103W probably damaging Het
Gas2l2 A C 11: 83,429,353 S26A probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gramd1a A T 7: 31,143,796 I29N probably benign Het
Grem2 A G 1: 174,836,884 V133A probably damaging Het
Hydin T A 8: 110,506,968 S1813T possibly damaging Het
Igkv3-2 T C 6: 70,699,039 F111L probably benign Het
Ints8 T C 4: 11,252,878 Q68R probably damaging Het
Irx5 A G 8: 92,359,726 I146V probably damaging Het
Kcnh3 T C 15: 99,238,243 L707P probably damaging Het
Kcnk4 T A 19: 6,928,297 I101F probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lmbr1 C T 5: 29,378,168 A9T probably benign Het
Map10 G T 8: 125,672,384 E839* probably null Het
Nectin4 C A 1: 171,386,753 A492D probably damaging Het
Nfat5 T A 8: 107,355,508 probably null Het
Olfr467 A G 7: 107,814,694 T37A probably benign Het
Plec A G 15: 76,177,884 Y2608H probably benign Het
Pold3 A G 7: 100,100,632 S42P probably benign Het
Ppp2r1a G T 17: 20,960,631 G432* probably null Het
Qk T C 17: 10,215,465 E315G probably benign Het
Rfx2 C T 17: 56,784,397 V354I probably benign Het
Rp1 T C 1: 4,347,886 Y1001C probably benign Het
Sez6l A G 5: 112,461,141 probably null Het
Slc39a14 A G 14: 70,309,886 I337T probably damaging Het
Slc3a2 G T 19: 8,709,319 L76M probably damaging Het
Slco1a5 T C 6: 142,237,534 T555A probably benign Het
Sprr2e A T 3: 92,353,034 K57N unknown Het
Syne2 A G 12: 75,943,901 T1886A probably damaging Het
Tenm3 A T 8: 48,236,063 I2147N probably damaging Het
Thbs1 G T 2: 118,119,847 G654W probably damaging Het
Tigd5 A G 15: 75,910,503 Y238C possibly damaging Het
Tmem221 A G 8: 71,557,849 F126S probably damaging Het
Trp63 C A 16: 25,763,358 P52Q probably damaging Het
Ugp2 A T 11: 21,328,883 S434R probably benign Het
Vmn2r69 A C 7: 85,407,170 F587V probably benign Het
Vps13d T A 4: 145,057,495 N3872I possibly damaging Het
Wdfy2 A G 14: 62,948,666 Y250C probably damaging Het
Zbtb16 T C 9: 48,665,319 D487G possibly damaging Het
Other mutations in Klhl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Klhl9 APN 4 88720819 missense probably damaging 1.00
IGL00592:Klhl9 APN 4 88721141 missense probably damaging 0.99
IGL01986:Klhl9 APN 4 88721779 missense probably damaging 0.99
IGL02364:Klhl9 APN 4 88721170 missense probably damaging 1.00
IGL02994:Klhl9 APN 4 88721197 nonsense probably null
minnow UTSW 4 88721606 nonsense probably null
R0319:Klhl9 UTSW 4 88720454 missense possibly damaging 0.91
R0360:Klhl9 UTSW 4 88720290 missense probably benign 0.05
R0364:Klhl9 UTSW 4 88720290 missense probably benign 0.05
R0693:Klhl9 UTSW 4 88720290 missense probably benign 0.05
R0961:Klhl9 UTSW 4 88721737 missense probably benign 0.16
R1521:Klhl9 UTSW 4 88721993 missense probably benign 0.03
R2891:Klhl9 UTSW 4 88720970 missense probably benign 0.02
R3762:Klhl9 UTSW 4 88721593 missense possibly damaging 0.93
R4584:Klhl9 UTSW 4 88721907 missense probably damaging 1.00
R4678:Klhl9 UTSW 4 88720924 missense probably damaging 1.00
R4888:Klhl9 UTSW 4 88721945 missense probably benign 0.01
R5030:Klhl9 UTSW 4 88720534 missense possibly damaging 0.96
R5082:Klhl9 UTSW 4 88721385 missense probably damaging 0.97
R7032:Klhl9 UTSW 4 88721606 nonsense probably null
R7532:Klhl9 UTSW 4 88720853 missense possibly damaging 0.79
R7602:Klhl9 UTSW 4 88722409 start gained probably benign
R7618:Klhl9 UTSW 4 88720535 missense possibly damaging 0.80
R7879:Klhl9 UTSW 4 88720338 missense probably damaging 1.00
R7909:Klhl9 UTSW 4 88721001 missense probably benign 0.12
R7962:Klhl9 UTSW 4 88720338 missense probably damaging 1.00
R7990:Klhl9 UTSW 4 88721001 missense probably benign 0.12
X0063:Klhl9 UTSW 4 88721951 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTATCGAGGAGCATCCATGG -3'
(R):5'- TAGTCTCAAGCACTGTTCGG -3'

Sequencing Primer
(F):5'- AGCATCCATGGGCGCTAAC -3'
(R):5'- CAAGCACTGTTCGGAACTTG -3'
Posted On2018-05-21