Incidental Mutation 'R6466:Lmbr1'
ID516573
Institutional Source Beutler Lab
Gene Symbol Lmbr1
Ensembl Gene ENSMUSG00000010721
Gene Namelimb region 1
Synonyms1110048D14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6466 (G1)
Quality Score100.008
Status Validated
Chromosome5
Chromosomal Location29229802-29378390 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29378168 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 9 (A9T)
Ref Sequence ENSEMBL: ENSMUSP00000136160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055195] [ENSMUST00000179191] [ENSMUST00000196321] [ENSMUST00000198105] [ENSMUST00000200564]
Predicted Effect probably benign
Transcript: ENSMUST00000055195
AA Change: A9T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000058405
Gene: ENSMUSG00000010721
AA Change: A9T

DomainStartEndE-ValueType
Pfam:LMBR1 26 281 3.5e-46 PFAM
Pfam:LMBR1 239 445 1.7e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179191
AA Change: A9T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000136160
Gene: ENSMUSG00000010721
AA Change: A9T

DomainStartEndE-ValueType
Pfam:LMBR1 23 108 6e-31 PFAM
Pfam:LMBR1 106 418 5.3e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181005
Predicted Effect probably benign
Transcript: ENSMUST00000196321
SMART Domains Protein: ENSMUSP00000143348
Gene: ENSMUSG00000010721

DomainStartEndE-ValueType
Pfam:LMBR1 1 323 4e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198105
AA Change: A9T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000142755
Gene: ENSMUSG00000010721
AA Change: A9T

DomainStartEndE-ValueType
Pfam:LMBR1 23 107 5.4e-30 PFAM
Pfam:LMBR1 106 419 3.4e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200564
SMART Domains Protein: ENSMUSP00000143316
Gene: ENSMUSG00000010721

DomainStartEndE-ValueType
Pfam:LMBR1 1 310 8.6e-92 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes a member of the LMBR1-like membrane protein family. Another member of this protein family has been shown to be a lipocalin transmembrane receptor. A highly conserved, cis-acting regulatory module for the sonic hedgehog gene is located within an intron of this gene. Consequently, disruption of this genic region can alter sonic hedgehog expression and affect limb patterning, but it is not known if this gene functions directly in limb development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show minor coalitions of distal wrist bones and a low incidence of limb defects, including oligodactyly, brachyphalangia, and soft tissue or bony syndactyly. Homozygotes for another null allele exhibit normal morphology,clinical chemistry, hematology and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik A T 8: 120,608,996 D69E probably damaging Het
Adgrv1 G T 13: 81,575,101 probably null Het
Ahr A T 12: 35,504,032 V696E probably benign Het
Akap13 A G 7: 75,727,044 T2007A probably benign Het
Arid1b T C 17: 5,327,678 F753S probably damaging Het
BC055324 G T 1: 163,954,165 R898S probably benign Het
Bpifb3 G T 2: 153,922,188 K105N probably damaging Het
C2cd2 A G 16: 97,879,622 C331R probably benign Het
Chrm1 T A 19: 8,678,178 Y82* probably null Het
Clcn3 A C 8: 60,929,561 V331G probably damaging Het
Dchs1 A T 7: 105,764,541 D1022E probably benign Het
Dnah2 T A 11: 69,539,415 T106S probably benign Het
Fam171a2 T A 11: 102,439,885 D256V probably damaging Het
Fmn2 T A 1: 174,609,583 probably benign Het
Fut11 C T 14: 20,695,309 R103W probably damaging Het
Gas2l2 A C 11: 83,429,353 S26A probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gramd1a A T 7: 31,143,796 I29N probably benign Het
Grem2 A G 1: 174,836,884 V133A probably damaging Het
Hydin T A 8: 110,506,968 S1813T possibly damaging Het
Igkv3-2 T C 6: 70,699,039 F111L probably benign Het
Ints8 T C 4: 11,252,878 Q68R probably damaging Het
Irx5 A G 8: 92,359,726 I146V probably damaging Het
Kcnh3 T C 15: 99,238,243 L707P probably damaging Het
Kcnk4 T A 19: 6,928,297 I101F probably damaging Het
Klhl9 A G 4: 88,721,162 Y281H probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Map10 G T 8: 125,672,384 E839* probably null Het
Nectin4 C A 1: 171,386,753 A492D probably damaging Het
Nfat5 T A 8: 107,355,508 probably null Het
Olfr467 A G 7: 107,814,694 T37A probably benign Het
Plec A G 15: 76,177,884 Y2608H probably benign Het
Pold3 A G 7: 100,100,632 S42P probably benign Het
Ppp2r1a G T 17: 20,960,631 G432* probably null Het
Qk T C 17: 10,215,465 E315G probably benign Het
Rfx2 C T 17: 56,784,397 V354I probably benign Het
Rp1 T C 1: 4,347,886 Y1001C probably benign Het
Sez6l A G 5: 112,461,141 probably null Het
Slc39a14 A G 14: 70,309,886 I337T probably damaging Het
Slc3a2 G T 19: 8,709,319 L76M probably damaging Het
Slco1a5 T C 6: 142,237,534 T555A probably benign Het
Sprr2e A T 3: 92,353,034 K57N unknown Het
Syne2 A G 12: 75,943,901 T1886A probably damaging Het
Tenm3 A T 8: 48,236,063 I2147N probably damaging Het
Thbs1 G T 2: 118,119,847 G654W probably damaging Het
Tigd5 A G 15: 75,910,503 Y238C possibly damaging Het
Tmem221 A G 8: 71,557,849 F126S probably damaging Het
Trp63 C A 16: 25,763,358 P52Q probably damaging Het
Ugp2 A T 11: 21,328,883 S434R probably benign Het
Vmn2r69 A C 7: 85,407,170 F587V probably benign Het
Vps13d T A 4: 145,057,495 N3872I possibly damaging Het
Wdfy2 A G 14: 62,948,666 Y250C probably damaging Het
Zbtb16 T C 9: 48,665,319 D487G possibly damaging Het
Other mutations in Lmbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Lmbr1 APN 5 29235055 missense probably damaging 1.00
IGL02285:Lmbr1 APN 5 29254235 splice site probably benign
IGL02793:Lmbr1 APN 5 29292188 missense probably damaging 1.00
IGL02875:Lmbr1 APN 5 29292188 missense probably damaging 1.00
IGL03103:Lmbr1 APN 5 29235016 missense probably damaging 0.99
IGL02988:Lmbr1 UTSW 5 29292223 splice site probably null
R0255:Lmbr1 UTSW 5 29252755 missense probably damaging 1.00
R0594:Lmbr1 UTSW 5 29292209 missense possibly damaging 0.87
R0993:Lmbr1 UTSW 5 29287393 missense probably damaging 1.00
R1036:Lmbr1 UTSW 5 29258747 missense probably damaging 1.00
R1570:Lmbr1 UTSW 5 29254558 missense probably damaging 1.00
R1724:Lmbr1 UTSW 5 29361083 missense probably benign 0.03
R2056:Lmbr1 UTSW 5 29233094 missense probably benign 0.07
R2996:Lmbr1 UTSW 5 29363933 missense probably benign 0.29
R4082:Lmbr1 UTSW 5 29258755 missense probably damaging 1.00
R4618:Lmbr1 UTSW 5 29346865 missense probably damaging 1.00
R4842:Lmbr1 UTSW 5 29287426 missense probably damaging 0.97
R4857:Lmbr1 UTSW 5 29323809 missense probably damaging 0.98
R5495:Lmbr1 UTSW 5 29346853 nonsense probably null
R5647:Lmbr1 UTSW 5 29263393 critical splice donor site probably null
R6393:Lmbr1 UTSW 5 29254294 missense probably damaging 1.00
R6486:Lmbr1 UTSW 5 29323861 missense probably damaging 0.99
R6576:Lmbr1 UTSW 5 29291310 missense probably damaging 1.00
R6874:Lmbr1 UTSW 5 29292906 missense probably damaging 1.00
R7085:Lmbr1 UTSW 5 29361092 splice site probably null
R7484:Lmbr1 UTSW 5 29346852 start gained probably benign
R7487:Lmbr1 UTSW 5 29254264 missense probably benign 0.38
Z1088:Lmbr1 UTSW 5 29323816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGAACGGGTCTCAAGTG -3'
(R):5'- TTGAACCGCTTCTCCCTGAG -3'

Sequencing Primer
(F):5'- ACGGGTCTCAAGTGATGCG -3'
(R):5'- AGCTCAGGCGGCGTTTTC -3'
Posted On2018-05-21