Mutagenetix > Incidental Mutation

Incidental Mutation 'R6466:Slco1a5'

516576

Institutional Source

Beutler Lab

Gene Symbol

Slco1a5

Ensembl Gene

ENSMUSG00000063975

Gene Name

solute carrier organic anion transporter family, member 1a5

Synonyms

Oatp3, Slc21a7

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R6466 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

142234227-142322981 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 142237534 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 555 (T555A)

Ref Sequence

ENSEMBL: ENSMUSP00000137607 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081380] [ENSMUST00000111825] [ENSMUST00000153268]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000081380
AA Change: T555A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000080116
Gene: ENSMUSG00000063975
AA Change: T555A

Domain	Start	End	E-Value	Type
Pfam:MFS_1	22	420	4.3e-30	PFAM
KAZAL	438	486	2.18e0	SMART
transmembrane domain	600	622	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111825
AA Change: T555A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000137607
Gene: ENSMUSG00000063975
AA Change: T555A

Domain	Start	End	E-Value	Type
Pfam:MFS_1	22	420	5.8e-30	PFAM
KAZAL	438	486	2.18e0	SMART
transmembrane domain	600	622	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153268

SMART Domains

Protein: ENSMUSP00000124829
Gene: ENSMUSG00000063975

Domain	Start	End	E-Value	Type
Pfam:OATP	19	74	3.4e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157614

Meta Mutation Damage Score

0.0987

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.3%
20x: 91.1%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium-independent transporter which mediates cellular uptake of organic ions in the liver. Its substrates include bile acids, bromosulphophthalein, and some steroidal compounds. The protein is a member of the SLC21A family of solute carriers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased percentage of CD8 ells and increased percentage of B cells in the peripheral blood. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190005I06Rik	A	T	8: 120,608,996	D69E	probably damaging	Het
Adgrv1	G	T	13: 81,575,101		probably null	Het
Ahr	A	T	12: 35,504,032	V696E	probably benign	Het
Akap13	A	G	7: 75,727,044	T2007A	probably benign	Het
Arid1b	T	C	17: 5,327,678	F753S	probably damaging	Het
BC055324	G	T	1: 163,954,165	R898S	probably benign	Het
Bpifb3	G	T	2: 153,922,188	K105N	probably damaging	Het
C2cd2	A	G	16: 97,879,622	C331R	probably benign	Het
Chrm1	T	A	19: 8,678,178	Y82*	probably null	Het
Clcn3	A	C	8: 60,929,561	V331G	probably damaging	Het
Dchs1	A	T	7: 105,764,541	D1022E	probably benign	Het
Dnah2	T	A	11: 69,539,415	T106S	probably benign	Het
Fam171a2	T	A	11: 102,439,885	D256V	probably damaging	Het
Fmn2	T	A	1: 174,609,583		probably benign	Het
Fut11	C	T	14: 20,695,309	R103W	probably damaging	Het
Gas2l2	A	C	11: 83,429,353	S26A	probably damaging	Het
Gm13178	T	A	4: 144,703,867	D184V	probably damaging	Het
Gramd1a	A	T	7: 31,143,796	I29N	probably benign	Het
Grem2	A	G	1: 174,836,884	V133A	probably damaging	Het
Hydin	T	A	8: 110,506,968	S1813T	possibly damaging	Het
Igkv3-2	T	C	6: 70,699,039	F111L	probably benign	Het
Ints8	T	C	4: 11,252,878	Q68R	probably damaging	Het
Irx5	A	G	8: 92,359,726	I146V	probably damaging	Het
Kcnh3	T	C	15: 99,238,243	L707P	probably damaging	Het
Kcnk4	T	A	19: 6,928,297	I101F	probably damaging	Het
Klhl9	A	G	4: 88,721,162	Y281H	probably benign	Het
Klra9	G	T	6: 130,179,032	Y253*	probably null	Het
Lmbr1	C	T	5: 29,378,168	A9T	probably benign	Het
Map10	G	T	8: 125,672,384	E839*	probably null	Het
Nectin4	C	A	1: 171,386,753	A492D	probably damaging	Het
Nfat5	T	A	8: 107,355,508		probably null	Het
Olfr467	A	G	7: 107,814,694	T37A	probably benign	Het
Plec	A	G	15: 76,177,884	Y2608H	probably benign	Het
Pold3	A	G	7: 100,100,632	S42P	probably benign	Het
Ppp2r1a	G	T	17: 20,960,631	G432*	probably null	Het
Qk	T	C	17: 10,215,465	E315G	probably benign	Het
Rfx2	C	T	17: 56,784,397	V354I	probably benign	Het
Rp1	T	C	1: 4,347,886	Y1001C	probably benign	Het
Sez6l	A	G	5: 112,461,141		probably null	Het
Slc39a14	A	G	14: 70,309,886	I337T	probably damaging	Het
Slc3a2	G	T	19: 8,709,319	L76M	probably damaging	Het
Sprr2e	A	T	3: 92,353,034	K57N	unknown	Het
Syne2	A	G	12: 75,943,901	T1886A	probably damaging	Het
Tenm3	A	T	8: 48,236,063	I2147N	probably damaging	Het
Thbs1	G	T	2: 118,119,847	G654W	probably damaging	Het
Tigd5	A	G	15: 75,910,503	Y238C	possibly damaging	Het
Tmem221	A	G	8: 71,557,849	F126S	probably damaging	Het
Trp63	C	A	16: 25,763,358	P52Q	probably damaging	Het
Ugp2	A	T	11: 21,328,883	S434R	probably benign	Het
Vmn2r69	A	C	7: 85,407,170	F587V	probably benign	Het
Vps13d	T	A	4: 145,057,495	N3872I	possibly damaging	Het
Wdfy2	A	G	14: 62,948,666	Y250C	probably damaging	Het
Zbtb16	T	C	9: 48,665,319	D487G	possibly damaging	Het

Other mutations in Slco1a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01304:Slco1a5	APN	6	142242150	missense	probably benign	0.00
IGL01432:Slco1a5	APN	6	142236286	missense	possibly damaging	0.59
IGL01590:Slco1a5	APN	6	142250319	missense	probably benign	0.01
IGL01824:Slco1a5	APN	6	142253037	missense	probably benign	0.01
IGL01915:Slco1a5	APN	6	142243873	missense	probably benign	0.00
IGL01945:Slco1a5	APN	6	142243989	critical splice acceptor site	probably null
IGL02078:Slco1a5	APN	6	142254446	missense	probably benign	0.30
IGL02178:Slco1a5	APN	6	142262688	nonsense	probably null
IGL02366:Slco1a5	APN	6	142250215	missense	possibly damaging	0.57
IGL02395:Slco1a5	APN	6	142275487	missense	probably damaging	0.99
IGL02621:Slco1a5	APN	6	142242015	missense	probably benign	0.10
IGL02752:Slco1a5	APN	6	142262712	missense	probably benign	0.07
IGL02940:Slco1a5	APN	6	142242005	missense	probably damaging	1.00
IGL03065:Slco1a5	APN	6	142248843	splice site	probably benign
IGL03377:Slco1a5	APN	6	142234766	missense	probably benign	0.01
R0017:Slco1a5	UTSW	6	142236335	splice site	probably benign
R0017:Slco1a5	UTSW	6	142236335	splice site	probably benign
R0230:Slco1a5	UTSW	6	142236328	splice site	probably benign
R0690:Slco1a5	UTSW	6	142268278	missense	probably benign	0.24
R1217:Slco1a5	UTSW	6	142254374	missense	probably damaging	0.98
R1900:Slco1a5	UTSW	6	142242063	missense	probably benign	0.44
R2084:Slco1a5	UTSW	6	142234711	missense	probably benign	0.32
R2393:Slco1a5	UTSW	6	142248775	missense	possibly damaging	0.85
R2414:Slco1a5	UTSW	6	142236250	missense	probably damaging	1.00
R2760:Slco1a5	UTSW	6	142250271	missense	probably benign	0.00
R3420:Slco1a5	UTSW	6	142268238	missense	possibly damaging	0.61
R3421:Slco1a5	UTSW	6	142268238	missense	possibly damaging	0.61
R3827:Slco1a5	UTSW	6	142253249	missense	probably damaging	0.97
R3963:Slco1a5	UTSW	6	142248644	critical splice donor site	probably null
R3977:Slco1a5	UTSW	6	142258972	splice site	probably benign
R4074:Slco1a5	UTSW	6	142268224	missense	possibly damaging	0.88
R4075:Slco1a5	UTSW	6	142268224	missense	possibly damaging	0.88
R4076:Slco1a5	UTSW	6	142268224	missense	possibly damaging	0.88
R4782:Slco1a5	UTSW	6	142248807	missense	possibly damaging	0.82
R4799:Slco1a5	UTSW	6	142248807	missense	possibly damaging	0.82
R4831:Slco1a5	UTSW	6	142234705	missense	probably benign
R5038:Slco1a5	UTSW	6	142262637	missense	probably benign	0.01
R5038:Slco1a5	UTSW	6	142266364	missense	probably damaging	1.00
R5063:Slco1a5	UTSW	6	142259065	missense	probably damaging	1.00
R5273:Slco1a5	UTSW	6	142242098	missense	probably benign	0.00
R5436:Slco1a5	UTSW	6	142254392	missense	probably damaging	1.00
R5579:Slco1a5	UTSW	6	142242125	missense	possibly damaging	0.93
R5602:Slco1a5	UTSW	6	142275529	start gained	probably benign
R5643:Slco1a5	UTSW	6	142237594	splice site	probably null
R5644:Slco1a5	UTSW	6	142237594	splice site	probably null
R5686:Slco1a5	UTSW	6	142236307	missense	probably damaging	1.00
R5699:Slco1a5	UTSW	6	142248816	missense	probably damaging	0.96
R5792:Slco1a5	UTSW	6	142242113	missense	probably damaging	1.00
R5938:Slco1a5	UTSW	6	142248717	missense	probably damaging	0.97
R5997:Slco1a5	UTSW	6	142253113	missense	probably benign	0.19
R6146:Slco1a5	UTSW	6	142234808	missense	probably benign
R6377:Slco1a5	UTSW	6	142242180	splice site	probably null
R6523:Slco1a5	UTSW	6	142266395	missense	probably damaging	1.00
R7092:Slco1a5	UTSW	6	142248675	missense	probably benign
R7207:Slco1a5	UTSW	6	142248749	nonsense	probably null
R7356:Slco1a5	UTSW	6	142234732	missense	probably benign	0.01
R7430:Slco1a5	UTSW	6	142248712	missense	probably benign	0.00
R7445:Slco1a5	UTSW	6	142259008	missense	possibly damaging	0.93
R7499:Slco1a5	UTSW	6	142262531	splice site	probably null
R7579:Slco1a5	UTSW	6	142275481	missense	probably benign	0.00
R8117:Slco1a5	UTSW	6	142262692	missense	probably damaging	1.00
R8209:Slco1a5	UTSW	6	142262682	missense	probably damaging	1.00
R8217:Slco1a5	UTSW	6	142275476	missense	probably benign	0.13
R8358:Slco1a5	UTSW	6	142262685	missense	probably benign	0.45
R8710:Slco1a5	UTSW	6	142253102	missense	probably benign	0.03
R9071:Slco1a5	UTSW	6	142250326	missense	possibly damaging	0.50
R9316:Slco1a5	UTSW	6	142250209	missense	probably damaging	0.99
R9427:Slco1a5	UTSW	6	142268275	missense	probably damaging	0.98
R9619:Slco1a5	UTSW	6	142253120	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- GGAGAACACACCTATGTTAAAGATG -3'
(R):5'- GCATTAGGATCATGAACTACCAC -3'

Sequencing Primer
(F):5'- GATAACCTGAATCTGTGTGCCCAAG -3'
(R):5'- CTACCACTGTCATTGGGAAGATGC -3'

Posted On

2018-05-21