Incidental Mutation 'R6466:Olfr467'
ID516582
Institutional Source Beutler Lab
Gene Symbol Olfr467
Ensembl Gene ENSMUSG00000066242
Gene Nameolfactory receptor 467
SynonymsMOR204-33P, GA_x6K02T2PBJ9-10144091-10145011
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6466 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107812263-107816336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107814694 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 37 (T37A)
Ref Sequence ENSEMBL: ENSMUSP00000149295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084756] [ENSMUST00000208563] [ENSMUST00000214253]
Predicted Effect probably benign
Transcript: ENSMUST00000084756
AA Change: T39A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081811
Gene: ENSMUSG00000066242
AA Change: T39A

DomainStartEndE-ValueType
Pfam:7tm_4 33 308 5.3e-52 PFAM
Pfam:7TM_GPCR_Srsx 37 307 8.3e-7 PFAM
Pfam:7tm_1 43 292 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207203
Predicted Effect probably benign
Transcript: ENSMUST00000208563
AA Change: T37A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214253
AA Change: T37A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik A T 8: 120,608,996 D69E probably damaging Het
Adgrv1 G T 13: 81,575,101 probably null Het
Ahr A T 12: 35,504,032 V696E probably benign Het
Akap13 A G 7: 75,727,044 T2007A probably benign Het
Arid1b T C 17: 5,327,678 F753S probably damaging Het
BC055324 G T 1: 163,954,165 R898S probably benign Het
Bpifb3 G T 2: 153,922,188 K105N probably damaging Het
C2cd2 A G 16: 97,879,622 C331R probably benign Het
Chrm1 T A 19: 8,678,178 Y82* probably null Het
Clcn3 A C 8: 60,929,561 V331G probably damaging Het
Dchs1 A T 7: 105,764,541 D1022E probably benign Het
Dnah2 T A 11: 69,539,415 T106S probably benign Het
Fam171a2 T A 11: 102,439,885 D256V probably damaging Het
Fmn2 T A 1: 174,609,583 probably benign Het
Fut11 C T 14: 20,695,309 R103W probably damaging Het
Gas2l2 A C 11: 83,429,353 S26A probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gramd1a A T 7: 31,143,796 I29N probably benign Het
Grem2 A G 1: 174,836,884 V133A probably damaging Het
Hydin T A 8: 110,506,968 S1813T possibly damaging Het
Igkv3-2 T C 6: 70,699,039 F111L probably benign Het
Ints8 T C 4: 11,252,878 Q68R probably damaging Het
Irx5 A G 8: 92,359,726 I146V probably damaging Het
Kcnh3 T C 15: 99,238,243 L707P probably damaging Het
Kcnk4 T A 19: 6,928,297 I101F probably damaging Het
Klhl9 A G 4: 88,721,162 Y281H probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lmbr1 C T 5: 29,378,168 A9T probably benign Het
Map10 G T 8: 125,672,384 E839* probably null Het
Nectin4 C A 1: 171,386,753 A492D probably damaging Het
Nfat5 T A 8: 107,355,508 probably null Het
Plec A G 15: 76,177,884 Y2608H probably benign Het
Pold3 A G 7: 100,100,632 S42P probably benign Het
Ppp2r1a G T 17: 20,960,631 G432* probably null Het
Qk T C 17: 10,215,465 E315G probably benign Het
Rfx2 C T 17: 56,784,397 V354I probably benign Het
Rp1 T C 1: 4,347,886 Y1001C probably benign Het
Sez6l A G 5: 112,461,141 probably null Het
Slc39a14 A G 14: 70,309,886 I337T probably damaging Het
Slc3a2 G T 19: 8,709,319 L76M probably damaging Het
Slco1a5 T C 6: 142,237,534 T555A probably benign Het
Sprr2e A T 3: 92,353,034 K57N unknown Het
Syne2 A G 12: 75,943,901 T1886A probably damaging Het
Tenm3 A T 8: 48,236,063 I2147N probably damaging Het
Thbs1 G T 2: 118,119,847 G654W probably damaging Het
Tigd5 A G 15: 75,910,503 Y238C possibly damaging Het
Tmem221 A G 8: 71,557,849 F126S probably damaging Het
Trp63 C A 16: 25,763,358 P52Q probably damaging Het
Ugp2 A T 11: 21,328,883 S434R probably benign Het
Vmn2r69 A C 7: 85,407,170 F587V probably benign Het
Vps13d T A 4: 145,057,495 N3872I possibly damaging Het
Wdfy2 A G 14: 62,948,666 Y250C probably damaging Het
Zbtb16 T C 9: 48,665,319 D487G possibly damaging Het
Other mutations in Olfr467
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0110:Olfr467 UTSW 7 107814688 missense probably damaging 1.00
R0450:Olfr467 UTSW 7 107814688 missense probably damaging 1.00
R0707:Olfr467 UTSW 7 107815124 missense probably damaging 0.99
R0918:Olfr467 UTSW 7 107815211 missense probably benign 0.03
R1416:Olfr467 UTSW 7 107815262 missense probably damaging 1.00
R1988:Olfr467 UTSW 7 107814700 missense probably benign
R1989:Olfr467 UTSW 7 107814700 missense probably benign
R2219:Olfr467 UTSW 7 107815222 missense probably benign
R2241:Olfr467 UTSW 7 107814833 missense possibly damaging 0.62
R2866:Olfr467 UTSW 7 107814919 missense probably benign 0.06
R4946:Olfr467 UTSW 7 107815382 missense possibly damaging 0.90
R4972:Olfr467 UTSW 7 107814746 missense probably benign 0.10
R5099:Olfr467 UTSW 7 107814602 missense probably benign 0.00
R5310:Olfr467 UTSW 7 107814964 missense probably damaging 1.00
R5323:Olfr467 UTSW 7 107814676 missense possibly damaging 0.96
R5531:Olfr467 UTSW 7 107815244 missense probably benign 0.03
R5672:Olfr467 UTSW 7 107814637 missense probably damaging 1.00
R5758:Olfr467 UTSW 7 107814815 missense probably damaging 0.99
R5891:Olfr467 UTSW 7 107815180 missense probably damaging 1.00
R6016:Olfr467 UTSW 7 107815012 missense probably benign 0.01
R6399:Olfr467 UTSW 7 107814754 missense possibly damaging 0.78
R6894:Olfr467 UTSW 7 107815064 missense probably benign 0.25
R7543:Olfr467 UTSW 7 107815101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGTGGAGTGGTGTATGTCAATC -3'
(R):5'- ACATCAGAGCCAAGCTGGAC -3'

Sequencing Primer
(F):5'- AGTGGTGTATGTCAATCATGAGG -3'
(R):5'- TCAGAGCCAAGCTGGACTATGC -3'
Posted On2018-05-21