Incidental Mutation 'R6466:Ugp2'
ID516591
Institutional Source Beutler Lab
Gene Symbol Ugp2
Ensembl Gene ENSMUSG00000001891
Gene NameUDP-glucose pyrophosphorylase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6466 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location21321138-21371201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21328883 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 434 (S434R)
Ref Sequence ENSEMBL: ENSMUSP00000099939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060895] [ENSMUST00000102875]
Predicted Effect probably benign
Transcript: ENSMUST00000060895
AA Change: S423R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000056324
Gene: ENSMUSG00000001891
AA Change: S423R

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
Pfam:UDPGP 43 462 2.1e-197 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102875
AA Change: S434R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099939
Gene: ENSMUSG00000001891
AA Change: S434R

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:UDPGP 55 473 3.5e-201 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133343
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is an important intermediary in mammalian carbohydrate interconversions. It transfers a glucose moiety from glucose-1-phosphate to MgUTP and forms UDP-glucose and MgPPi. In liver and muscle tissue, UDP-glucose is a direct precursor of glycogen; in lactating mammary gland it is converted to UDP-galactose which is then converted to lactose. The eukaryotic enzyme has no significant sequence similarity to the prokaryotic enzyme. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik A T 8: 120,608,996 D69E probably damaging Het
Adgrv1 G T 13: 81,575,101 probably null Het
Ahr A T 12: 35,504,032 V696E probably benign Het
Akap13 A G 7: 75,727,044 T2007A probably benign Het
Arid1b T C 17: 5,327,678 F753S probably damaging Het
BC055324 G T 1: 163,954,165 R898S probably benign Het
Bpifb3 G T 2: 153,922,188 K105N probably damaging Het
C2cd2 A G 16: 97,879,622 C331R probably benign Het
Chrm1 T A 19: 8,678,178 Y82* probably null Het
Clcn3 A C 8: 60,929,561 V331G probably damaging Het
Dchs1 A T 7: 105,764,541 D1022E probably benign Het
Dnah2 T A 11: 69,539,415 T106S probably benign Het
Fam171a2 T A 11: 102,439,885 D256V probably damaging Het
Fmn2 T A 1: 174,609,583 probably benign Het
Fut11 C T 14: 20,695,309 R103W probably damaging Het
Gas2l2 A C 11: 83,429,353 S26A probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gramd1a A T 7: 31,143,796 I29N probably benign Het
Grem2 A G 1: 174,836,884 V133A probably damaging Het
Hydin T A 8: 110,506,968 S1813T possibly damaging Het
Igkv3-2 T C 6: 70,699,039 F111L probably benign Het
Ints8 T C 4: 11,252,878 Q68R probably damaging Het
Irx5 A G 8: 92,359,726 I146V probably damaging Het
Kcnh3 T C 15: 99,238,243 L707P probably damaging Het
Kcnk4 T A 19: 6,928,297 I101F probably damaging Het
Klhl9 A G 4: 88,721,162 Y281H probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lmbr1 C T 5: 29,378,168 A9T probably benign Het
Map10 G T 8: 125,672,384 E839* probably null Het
Nectin4 C A 1: 171,386,753 A492D probably damaging Het
Nfat5 T A 8: 107,355,508 probably null Het
Olfr467 A G 7: 107,814,694 T37A probably benign Het
Plec A G 15: 76,177,884 Y2608H probably benign Het
Pold3 A G 7: 100,100,632 S42P probably benign Het
Ppp2r1a G T 17: 20,960,631 G432* probably null Het
Qk T C 17: 10,215,465 E315G probably benign Het
Rfx2 C T 17: 56,784,397 V354I probably benign Het
Rp1 T C 1: 4,347,886 Y1001C probably benign Het
Sez6l A G 5: 112,461,141 probably null Het
Slc39a14 A G 14: 70,309,886 I337T probably damaging Het
Slc3a2 G T 19: 8,709,319 L76M probably damaging Het
Slco1a5 T C 6: 142,237,534 T555A probably benign Het
Sprr2e A T 3: 92,353,034 K57N unknown Het
Syne2 A G 12: 75,943,901 T1886A probably damaging Het
Tenm3 A T 8: 48,236,063 I2147N probably damaging Het
Thbs1 G T 2: 118,119,847 G654W probably damaging Het
Tigd5 A G 15: 75,910,503 Y238C possibly damaging Het
Tmem221 A G 8: 71,557,849 F126S probably damaging Het
Trp63 C A 16: 25,763,358 P52Q probably damaging Het
Vmn2r69 A C 7: 85,407,170 F587V probably benign Het
Vps13d T A 4: 145,057,495 N3872I possibly damaging Het
Wdfy2 A G 14: 62,948,666 Y250C probably damaging Het
Zbtb16 T C 9: 48,665,319 D487G possibly damaging Het
Other mutations in Ugp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ugp2 APN 11 21354345 missense probably benign
IGL01161:Ugp2 APN 11 21323273 missense possibly damaging 0.82
IGL01759:Ugp2 APN 11 21353447 missense probably benign 0.01
IGL03037:Ugp2 APN 11 21332540 nonsense probably null
IGL03092:Ugp2 APN 11 21329722 splice site probably benign
bittern UTSW 11 21322051 unclassified probably null
PIT4377001:Ugp2 UTSW 11 21370203 start codon destroyed probably null 0.33
R1538:Ugp2 UTSW 11 21333791 missense possibly damaging 0.88
R1658:Ugp2 UTSW 11 21333774 missense probably benign
R1771:Ugp2 UTSW 11 21329915 missense probably damaging 1.00
R1874:Ugp2 UTSW 11 21329048 missense probably damaging 1.00
R1970:Ugp2 UTSW 11 21328942 missense probably damaging 0.99
R2143:Ugp2 UTSW 11 21328949 missense probably benign
R2431:Ugp2 UTSW 11 21329025 missense probably damaging 1.00
R3888:Ugp2 UTSW 11 21353366 missense probably benign 0.01
R4352:Ugp2 UTSW 11 21329026 missense probably damaging 0.99
R5018:Ugp2 UTSW 11 21331052 missense probably damaging 1.00
R6125:Ugp2 UTSW 11 21329815 missense probably damaging 0.97
R6388:Ugp2 UTSW 11 21322051 unclassified probably null
R6626:Ugp2 UTSW 11 21331028 missense probably damaging 1.00
R7219:Ugp2 UTSW 11 21323271 missense probably damaging 1.00
R7822:Ugp2 UTSW 11 21333762 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGACTAGTGAAAGCAGTCTC -3'
(R):5'- GGATGGAGGCCTGAATGTAATTC -3'

Sequencing Primer
(F):5'- CTGACTAGTGAAAGCAGTCTCAGAAG -3'
(R):5'- TTAGAAACTGCAGTTGGAGCTG -3'
Posted On2018-05-21