Incidental Mutation 'R6466:Slc39a14'
ID516599
Institutional Source Beutler Lab
Gene Symbol Slc39a14
Ensembl Gene ENSMUSG00000022094
Gene Namesolute carrier family 39 (zinc transporter), member 14
SynonymsZip14, G630015O18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R6466 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70303469-70351425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70309886 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 337 (I337T)
Ref Sequence ENSEMBL: ENSMUSP00000066108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022688] [ENSMUST00000068044] [ENSMUST00000152067]
Predicted Effect probably damaging
Transcript: ENSMUST00000022688
AA Change: I337T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022688
Gene: ENSMUSG00000022094
AA Change: I337T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Zip 149 480 4.4e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000068044
AA Change: I337T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066108
Gene: ENSMUSG00000022094
AA Change: I337T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Zip 149 480 5.4e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146453
Predicted Effect probably damaging
Transcript: ENSMUST00000152067
AA Change: I337T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119040
Gene: ENSMUSG00000022094
AA Change: I337T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Zip 149 480 3.3e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155825
Meta Mutation Damage Score 0.7903 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A14 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a null allele show dwarfism, scoliosis, osteopenia, short long bones, altered gluconeogenesis and chondrocyte differentiation, low plasma IGF-I and liver zinc levels. Homozygotes for another null allele show reduced liver zinc levels and hepatocyte proliferation after hepatectomy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik A T 8: 120,608,996 D69E probably damaging Het
Adgrv1 G T 13: 81,575,101 probably null Het
Ahr A T 12: 35,504,032 V696E probably benign Het
Akap13 A G 7: 75,727,044 T2007A probably benign Het
Arid1b T C 17: 5,327,678 F753S probably damaging Het
BC055324 G T 1: 163,954,165 R898S probably benign Het
Bpifb3 G T 2: 153,922,188 K105N probably damaging Het
C2cd2 A G 16: 97,879,622 C331R probably benign Het
Chrm1 T A 19: 8,678,178 Y82* probably null Het
Clcn3 A C 8: 60,929,561 V331G probably damaging Het
Dchs1 A T 7: 105,764,541 D1022E probably benign Het
Dnah2 T A 11: 69,539,415 T106S probably benign Het
Fam171a2 T A 11: 102,439,885 D256V probably damaging Het
Fmn2 T A 1: 174,609,583 probably benign Het
Fut11 C T 14: 20,695,309 R103W probably damaging Het
Gas2l2 A C 11: 83,429,353 S26A probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gramd1a A T 7: 31,143,796 I29N probably benign Het
Grem2 A G 1: 174,836,884 V133A probably damaging Het
Hydin T A 8: 110,506,968 S1813T possibly damaging Het
Igkv3-2 T C 6: 70,699,039 F111L probably benign Het
Ints8 T C 4: 11,252,878 Q68R probably damaging Het
Irx5 A G 8: 92,359,726 I146V probably damaging Het
Kcnh3 T C 15: 99,238,243 L707P probably damaging Het
Kcnk4 T A 19: 6,928,297 I101F probably damaging Het
Klhl9 A G 4: 88,721,162 Y281H probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lmbr1 C T 5: 29,378,168 A9T probably benign Het
Map10 G T 8: 125,672,384 E839* probably null Het
Nectin4 C A 1: 171,386,753 A492D probably damaging Het
Nfat5 T A 8: 107,355,508 probably null Het
Olfr467 A G 7: 107,814,694 T37A probably benign Het
Plec A G 15: 76,177,884 Y2608H probably benign Het
Pold3 A G 7: 100,100,632 S42P probably benign Het
Ppp2r1a G T 17: 20,960,631 G432* probably null Het
Qk T C 17: 10,215,465 E315G probably benign Het
Rfx2 C T 17: 56,784,397 V354I probably benign Het
Rp1 T C 1: 4,347,886 Y1001C probably benign Het
Sez6l A G 5: 112,461,141 probably null Het
Slc3a2 G T 19: 8,709,319 L76M probably damaging Het
Slco1a5 T C 6: 142,237,534 T555A probably benign Het
Sprr2e A T 3: 92,353,034 K57N unknown Het
Syne2 A G 12: 75,943,901 T1886A probably damaging Het
Tenm3 A T 8: 48,236,063 I2147N probably damaging Het
Thbs1 G T 2: 118,119,847 G654W probably damaging Het
Tigd5 A G 15: 75,910,503 Y238C possibly damaging Het
Tmem221 A G 8: 71,557,849 F126S probably damaging Het
Trp63 C A 16: 25,763,358 P52Q probably damaging Het
Ugp2 A T 11: 21,328,883 S434R probably benign Het
Vmn2r69 A C 7: 85,407,170 F587V probably benign Het
Vps13d T A 4: 145,057,495 N3872I possibly damaging Het
Wdfy2 A G 14: 62,948,666 Y250C probably damaging Het
Zbtb16 T C 9: 48,665,319 D487G possibly damaging Het
Other mutations in Slc39a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Slc39a14 APN 14 70306685 missense possibly damaging 0.91
IGL02348:Slc39a14 APN 14 70316436 critical splice donor site probably null
IGL03108:Slc39a14 APN 14 70318919 missense probably damaging 0.98
IGL03391:Slc39a14 APN 14 70309842 missense probably damaging 1.00
R1741:Slc39a14 UTSW 14 70318744 missense probably damaging 1.00
R2437:Slc39a14 UTSW 14 70316436 critical splice donor site probably null
R4726:Slc39a14 UTSW 14 70313599 critical splice donor site probably null
R4808:Slc39a14 UTSW 14 70315801 missense probably damaging 1.00
R4911:Slc39a14 UTSW 14 70309922 missense probably benign 0.00
R4957:Slc39a14 UTSW 14 70315811 missense probably damaging 0.99
R5815:Slc39a14 UTSW 14 70306745 missense probably damaging 1.00
R6393:Slc39a14 UTSW 14 70309813 missense probably benign 0.02
R6464:Slc39a14 UTSW 14 70306728 missense probably damaging 0.98
R6757:Slc39a14 UTSW 14 70310884 missense probably damaging 1.00
R6969:Slc39a14 UTSW 14 70308826 missense probably damaging 0.99
R7569:Slc39a14 UTSW 14 70309827 missense possibly damaging 0.66
R7711:Slc39a14 UTSW 14 70313675 missense probably damaging 1.00
R7830:Slc39a14 UTSW 14 70310117 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGAGACAGCTGGAACACG -3'
(R):5'- ACGAGAAGGTCATTGTCAACTCC -3'

Sequencing Primer
(F):5'- GGGGACAGGGACTAAGCACTC -3'
(R):5'- AACTCCATGTCTGTGCAGGTCAG -3'
Posted On2018-05-21