Incidental Mutation 'R6466:C2cd2'
ID516604
Institutional Source Beutler Lab
Gene Symbol C2cd2
Ensembl Gene ENSMUSG00000045975
Gene NameC2 calcium-dependent domain containing 2
SynonymsORF25, 5830404H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6466 (G1)
Quality Score219.009
Status Validated
Chromosome16
Chromosomal Location97855209-97962598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97879622 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 331 (C331R)
Ref Sequence ENSEMBL: ENSMUSP00000127368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170757] [ENSMUST00000232165]
Predicted Effect probably benign
Transcript: ENSMUST00000170757
AA Change: C331R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127368
Gene: ENSMUSG00000045975
AA Change: C331R

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 106 122 N/A INTRINSIC
Pfam:C2 232 359 1.9e-6 PFAM
low complexity region 410 421 N/A INTRINSIC
low complexity region 491 517 N/A INTRINSIC
low complexity region 605 616 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231332
Predicted Effect unknown
Transcript: ENSMUST00000231903
AA Change: C18R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232063
Predicted Effect probably benign
Transcript: ENSMUST00000232165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232572
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik A T 8: 120,608,996 D69E probably damaging Het
Adgrv1 G T 13: 81,575,101 probably null Het
Ahr A T 12: 35,504,032 V696E probably benign Het
Akap13 A G 7: 75,727,044 T2007A probably benign Het
Arid1b T C 17: 5,327,678 F753S probably damaging Het
BC055324 G T 1: 163,954,165 R898S probably benign Het
Bpifb3 G T 2: 153,922,188 K105N probably damaging Het
Chrm1 T A 19: 8,678,178 Y82* probably null Het
Clcn3 A C 8: 60,929,561 V331G probably damaging Het
Dchs1 A T 7: 105,764,541 D1022E probably benign Het
Dnah2 T A 11: 69,539,415 T106S probably benign Het
Fam171a2 T A 11: 102,439,885 D256V probably damaging Het
Fmn2 T A 1: 174,609,583 probably benign Het
Fut11 C T 14: 20,695,309 R103W probably damaging Het
Gas2l2 A C 11: 83,429,353 S26A probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gramd1a A T 7: 31,143,796 I29N probably benign Het
Grem2 A G 1: 174,836,884 V133A probably damaging Het
Hydin T A 8: 110,506,968 S1813T possibly damaging Het
Igkv3-2 T C 6: 70,699,039 F111L probably benign Het
Ints8 T C 4: 11,252,878 Q68R probably damaging Het
Irx5 A G 8: 92,359,726 I146V probably damaging Het
Kcnh3 T C 15: 99,238,243 L707P probably damaging Het
Kcnk4 T A 19: 6,928,297 I101F probably damaging Het
Klhl9 A G 4: 88,721,162 Y281H probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lmbr1 C T 5: 29,378,168 A9T probably benign Het
Map10 G T 8: 125,672,384 E839* probably null Het
Nectin4 C A 1: 171,386,753 A492D probably damaging Het
Nfat5 T A 8: 107,355,508 probably null Het
Olfr467 A G 7: 107,814,694 T37A probably benign Het
Plec A G 15: 76,177,884 Y2608H probably benign Het
Pold3 A G 7: 100,100,632 S42P probably benign Het
Ppp2r1a G T 17: 20,960,631 G432* probably null Het
Qk T C 17: 10,215,465 E315G probably benign Het
Rfx2 C T 17: 56,784,397 V354I probably benign Het
Rp1 T C 1: 4,347,886 Y1001C probably benign Het
Sez6l A G 5: 112,461,141 probably null Het
Slc39a14 A G 14: 70,309,886 I337T probably damaging Het
Slc3a2 G T 19: 8,709,319 L76M probably damaging Het
Slco1a5 T C 6: 142,237,534 T555A probably benign Het
Sprr2e A T 3: 92,353,034 K57N unknown Het
Syne2 A G 12: 75,943,901 T1886A probably damaging Het
Tenm3 A T 8: 48,236,063 I2147N probably damaging Het
Thbs1 G T 2: 118,119,847 G654W probably damaging Het
Tigd5 A G 15: 75,910,503 Y238C possibly damaging Het
Tmem221 A G 8: 71,557,849 F126S probably damaging Het
Trp63 C A 16: 25,763,358 P52Q probably damaging Het
Ugp2 A T 11: 21,328,883 S434R probably benign Het
Vmn2r69 A C 7: 85,407,170 F587V probably benign Het
Vps13d T A 4: 145,057,495 N3872I possibly damaging Het
Wdfy2 A G 14: 62,948,666 Y250C probably damaging Het
Zbtb16 T C 9: 48,665,319 D487G possibly damaging Het
Other mutations in C2cd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:C2cd2 APN 16 97870220 missense probably damaging 1.00
IGL01633:C2cd2 APN 16 97875123 splice site probably benign
IGL01731:C2cd2 APN 16 97870172 missense probably damaging 1.00
IGL02071:C2cd2 APN 16 97870232 missense probably damaging 1.00
IGL02086:C2cd2 APN 16 97890008 splice site probably benign
IGL02502:C2cd2 APN 16 97876390 missense possibly damaging 0.85
IGL02933:C2cd2 APN 16 97892201 missense probably benign 0.22
IGL03005:C2cd2 APN 16 97859432 missense probably damaging 0.99
IGL03493:C2cd2 APN 16 97881661 missense probably damaging 0.97
H8562:C2cd2 UTSW 16 97879640 missense possibly damaging 0.91
H8786:C2cd2 UTSW 16 97879640 missense possibly damaging 0.91
R0480:C2cd2 UTSW 16 97877148 missense probably benign 0.45
R0483:C2cd2 UTSW 16 97859588 splice site probably benign
R0541:C2cd2 UTSW 16 97922296 missense possibly damaging 0.66
R1294:C2cd2 UTSW 16 97922269 missense probably damaging 1.00
R1986:C2cd2 UTSW 16 97870271 missense probably damaging 1.00
R2518:C2cd2 UTSW 16 97922086 missense probably benign 0.01
R5468:C2cd2 UTSW 16 97868591 unclassified probably null
R5507:C2cd2 UTSW 16 97881620 missense probably benign 0.01
R5979:C2cd2 UTSW 16 97875218 missense probably benign 0.01
R7264:C2cd2 UTSW 16 97876219 critical splice donor site probably null
R7372:C2cd2 UTSW 16 97875380 missense
R8003:C2cd2 UTSW 16 97886086 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCCAAAGGAATGACACTGTTG -3'
(R):5'- AACCCTTGGTTGAATTGGTGGC -3'

Sequencing Primer
(F):5'- AGGAATGACACTGTTGATTCTTAAC -3'
(R):5'- GACTGACAACCATGTGTCTTTAG -3'
Posted On2018-05-21