Incidental Mutation 'R6466:Qk'
ID516606
Institutional Source Beutler Lab
Gene Symbol Qk
Ensembl Gene ENSMUSG00000062078
Gene Namequaking
SynonymsQkI, l(17)-1Wis, l17Wis1, 1110003F05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6466 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location10206471-10319361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10215465 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 315 (E315G)
Ref Sequence ENSEMBL: ENSMUSP00000046740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042296] [ENSMUST00000097414]
PDB Structure
Crystal structure of the Quaking Qua1 homodimerization domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000042296
AA Change: E315G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046740
Gene: ENSMUSG00000062078
AA Change: E315G

DomainStartEndE-ValueType
KH 80 174 4.74e-9 SMART
low complexity region 211 226 N/A INTRINSIC
low complexity region 230 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097414
SMART Domains Protein: ENSMUSP00000095025
Gene: ENSMUSG00000062078

DomainStartEndE-ValueType
Pfam:STAR_dimer 10 68 9.4e-31 PFAM
KH 80 174 4.74e-9 SMART
low complexity region 211 226 N/A INTRINSIC
low complexity region 230 250 N/A INTRINSIC
Pfam:Quaking_NLS 312 341 5.5e-24 PFAM
Meta Mutation Damage Score 0.5157 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA-binding protein that regulates pre-mRNA splicing, export of mRNAs from the nucleus, protein translation, and mRNA stability. The encoded protein is involved in myelinization and oligodendrocyte differentiation and may play a role in schizophrenia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Knock-out mice die in utero with defects in embryo turning, blood vessel, smooth muscle, cardiac and neural tube development. Homozygotes for a spontaneous allele are viable but show myelin, spermatogenic and behavioral defects, hind leg tremors and seizures. Most ENU-induced mutants die in utero. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik A T 8: 120,608,996 D69E probably damaging Het
Adgrv1 G T 13: 81,575,101 probably null Het
Ahr A T 12: 35,504,032 V696E probably benign Het
Akap13 A G 7: 75,727,044 T2007A probably benign Het
Arid1b T C 17: 5,327,678 F753S probably damaging Het
BC055324 G T 1: 163,954,165 R898S probably benign Het
Bpifb3 G T 2: 153,922,188 K105N probably damaging Het
C2cd2 A G 16: 97,879,622 C331R probably benign Het
Chrm1 T A 19: 8,678,178 Y82* probably null Het
Clcn3 A C 8: 60,929,561 V331G probably damaging Het
Dchs1 A T 7: 105,764,541 D1022E probably benign Het
Dnah2 T A 11: 69,539,415 T106S probably benign Het
Fam171a2 T A 11: 102,439,885 D256V probably damaging Het
Fmn2 T A 1: 174,609,583 probably benign Het
Fut11 C T 14: 20,695,309 R103W probably damaging Het
Gas2l2 A C 11: 83,429,353 S26A probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gramd1a A T 7: 31,143,796 I29N probably benign Het
Grem2 A G 1: 174,836,884 V133A probably damaging Het
Hydin T A 8: 110,506,968 S1813T possibly damaging Het
Igkv3-2 T C 6: 70,699,039 F111L probably benign Het
Ints8 T C 4: 11,252,878 Q68R probably damaging Het
Irx5 A G 8: 92,359,726 I146V probably damaging Het
Kcnh3 T C 15: 99,238,243 L707P probably damaging Het
Kcnk4 T A 19: 6,928,297 I101F probably damaging Het
Klhl9 A G 4: 88,721,162 Y281H probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lmbr1 C T 5: 29,378,168 A9T probably benign Het
Map10 G T 8: 125,672,384 E839* probably null Het
Nectin4 C A 1: 171,386,753 A492D probably damaging Het
Nfat5 T A 8: 107,355,508 probably null Het
Olfr467 A G 7: 107,814,694 T37A probably benign Het
Plec A G 15: 76,177,884 Y2608H probably benign Het
Pold3 A G 7: 100,100,632 S42P probably benign Het
Ppp2r1a G T 17: 20,960,631 G432* probably null Het
Rfx2 C T 17: 56,784,397 V354I probably benign Het
Rp1 T C 1: 4,347,886 Y1001C probably benign Het
Sez6l A G 5: 112,461,141 probably null Het
Slc39a14 A G 14: 70,309,886 I337T probably damaging Het
Slc3a2 G T 19: 8,709,319 L76M probably damaging Het
Slco1a5 T C 6: 142,237,534 T555A probably benign Het
Sprr2e A T 3: 92,353,034 K57N unknown Het
Syne2 A G 12: 75,943,901 T1886A probably damaging Het
Tenm3 A T 8: 48,236,063 I2147N probably damaging Het
Thbs1 G T 2: 118,119,847 G654W probably damaging Het
Tigd5 A G 15: 75,910,503 Y238C possibly damaging Het
Tmem221 A G 8: 71,557,849 F126S probably damaging Het
Trp63 C A 16: 25,763,358 P52Q probably damaging Het
Ugp2 A T 11: 21,328,883 S434R probably benign Het
Vmn2r69 A C 7: 85,407,170 F587V probably benign Het
Vps13d T A 4: 145,057,495 N3872I possibly damaging Het
Wdfy2 A G 14: 62,948,666 Y250C probably damaging Het
Zbtb16 T C 9: 48,665,319 D487G possibly damaging Het
Other mutations in Qk
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0165:Qk UTSW 17 10238963 missense probably damaging 1.00
R0268:Qk UTSW 17 10209646 splice site probably benign
R3963:Qk UTSW 17 10216465 splice site probably benign
R4732:Qk UTSW 17 10216288 missense probably damaging 0.98
R4733:Qk UTSW 17 10216288 missense probably damaging 0.98
R5153:Qk UTSW 17 10238891 critical splice donor site probably null
R5161:Qk UTSW 17 10215490 intron probably null
R5368:Qk UTSW 17 10239035 missense probably damaging 0.98
R5833:Qk UTSW 17 10216387 missense probably damaging 1.00
R6880:Qk UTSW 17 10215447 missense probably benign 0.00
R8068:Qk UTSW 17 10318803 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- TAGGAGTCAACAGCAGGCAC -3'
(R):5'- AGAGCTTCACTACCCAAAATTAGG -3'

Sequencing Primer
(F):5'- GTCAACAGCAGGCACACAGC -3'
(R):5'- AGTTTCAGTTTTAAGGGTTTTCAGC -3'
Posted On2018-05-21