Incidental Mutation 'R6466:Kcnk4'
ID516609
Institutional Source Beutler Lab
Gene Symbol Kcnk4
Ensembl Gene ENSMUSG00000024957
Gene Namepotassium channel, subfamily K, member 4
SynonymsTRAAKt
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6466 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6925710-6934515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6928297 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 101 (I101F)
Ref Sequence ENSEMBL: ENSMUSP00000025908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025908] [ENSMUST00000057716]
Predicted Effect probably damaging
Transcript: ENSMUST00000025908
AA Change: I101F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025908
Gene: ENSMUSG00000024957
AA Change: I101F

DomainStartEndE-ValueType
Pfam:Ion_trans 2 147 8.1e-9 PFAM
Pfam:Ion_trans_2 64 145 1.7e-21 PFAM
Pfam:Ion_trans_2 174 260 5.3e-22 PFAM
low complexity region 303 319 N/A INTRINSIC
low complexity region 367 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057716
SMART Domains Protein: ENSMUSP00000056681
Gene: ENSMUSG00000050623

DomainStartEndE-ValueType
low complexity region 104 118 N/A INTRINSIC
low complexity region 137 146 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TWIK-related arachidonic acid-stimulated two pore potassium channel subfamily. The encoded protein homodimerizes and functions as an outwardly rectifying channel. This channel is regulated by polyunsaturated fatty acids, temperature and mechanical deformation of the lipid membrane. This protein is expressed primarily in neural tissues and may be involved in regulating the noxious input threshold in dorsal root ganglia neurons. Alternate splicing results in multiple transcript variants. Naturally occurring read-through transcripts also exist between this gene and the downstream testis expressed 40 (TEX40) gene, as represented in GeneID: 106780802. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit normal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik A T 8: 120,608,996 D69E probably damaging Het
Adgrv1 G T 13: 81,575,101 probably null Het
Ahr A T 12: 35,504,032 V696E probably benign Het
Akap13 A G 7: 75,727,044 T2007A probably benign Het
Arid1b T C 17: 5,327,678 F753S probably damaging Het
BC055324 G T 1: 163,954,165 R898S probably benign Het
Bpifb3 G T 2: 153,922,188 K105N probably damaging Het
C2cd2 A G 16: 97,879,622 C331R probably benign Het
Chrm1 T A 19: 8,678,178 Y82* probably null Het
Clcn3 A C 8: 60,929,561 V331G probably damaging Het
Dchs1 A T 7: 105,764,541 D1022E probably benign Het
Dnah2 T A 11: 69,539,415 T106S probably benign Het
Fam171a2 T A 11: 102,439,885 D256V probably damaging Het
Fmn2 T A 1: 174,609,583 probably benign Het
Fut11 C T 14: 20,695,309 R103W probably damaging Het
Gas2l2 A C 11: 83,429,353 S26A probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gramd1a A T 7: 31,143,796 I29N probably benign Het
Grem2 A G 1: 174,836,884 V133A probably damaging Het
Hydin T A 8: 110,506,968 S1813T possibly damaging Het
Igkv3-2 T C 6: 70,699,039 F111L probably benign Het
Ints8 T C 4: 11,252,878 Q68R probably damaging Het
Irx5 A G 8: 92,359,726 I146V probably damaging Het
Kcnh3 T C 15: 99,238,243 L707P probably damaging Het
Klhl9 A G 4: 88,721,162 Y281H probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lmbr1 C T 5: 29,378,168 A9T probably benign Het
Map10 G T 8: 125,672,384 E839* probably null Het
Nectin4 C A 1: 171,386,753 A492D probably damaging Het
Nfat5 T A 8: 107,355,508 probably null Het
Olfr467 A G 7: 107,814,694 T37A probably benign Het
Plec A G 15: 76,177,884 Y2608H probably benign Het
Pold3 A G 7: 100,100,632 S42P probably benign Het
Ppp2r1a G T 17: 20,960,631 G432* probably null Het
Qk T C 17: 10,215,465 E315G probably benign Het
Rfx2 C T 17: 56,784,397 V354I probably benign Het
Rp1 T C 1: 4,347,886 Y1001C probably benign Het
Sez6l A G 5: 112,461,141 probably null Het
Slc39a14 A G 14: 70,309,886 I337T probably damaging Het
Slc3a2 G T 19: 8,709,319 L76M probably damaging Het
Slco1a5 T C 6: 142,237,534 T555A probably benign Het
Sprr2e A T 3: 92,353,034 K57N unknown Het
Syne2 A G 12: 75,943,901 T1886A probably damaging Het
Tenm3 A T 8: 48,236,063 I2147N probably damaging Het
Thbs1 G T 2: 118,119,847 G654W probably damaging Het
Tigd5 A G 15: 75,910,503 Y238C possibly damaging Het
Tmem221 A G 8: 71,557,849 F126S probably damaging Het
Trp63 C A 16: 25,763,358 P52Q probably damaging Het
Ugp2 A T 11: 21,328,883 S434R probably benign Het
Vmn2r69 A C 7: 85,407,170 F587V probably benign Het
Vps13d T A 4: 145,057,495 N3872I possibly damaging Het
Wdfy2 A G 14: 62,948,666 Y250C probably damaging Het
Zbtb16 T C 9: 48,665,319 D487G possibly damaging Het
Other mutations in Kcnk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Kcnk4 APN 19 6927177 missense probably damaging 1.00
IGL02047:Kcnk4 APN 19 6926258 missense probably benign 0.00
IGL02726:Kcnk4 APN 19 6927089 critical splice donor site probably null
R0149:Kcnk4 UTSW 19 6926194 missense probably benign 0.08
R0617:Kcnk4 UTSW 19 6928160 unclassified probably benign
R1392:Kcnk4 UTSW 19 6927663 missense possibly damaging 0.80
R1392:Kcnk4 UTSW 19 6927663 missense possibly damaging 0.80
R3017:Kcnk4 UTSW 19 6927794 missense probably damaging 0.96
R4439:Kcnk4 UTSW 19 6932761 missense probably benign 0.01
R4895:Kcnk4 UTSW 19 6928416 splice site probably null
R5208:Kcnk4 UTSW 19 6927701 missense possibly damaging 0.79
R5409:Kcnk4 UTSW 19 6926210 missense probably benign 0.00
R5743:Kcnk4 UTSW 19 6928355 missense possibly damaging 0.69
R6233:Kcnk4 UTSW 19 6928329 missense probably benign 0.29
R7358:Kcnk4 UTSW 19 6926110 missense probably damaging 1.00
R8040:Kcnk4 UTSW 19 6927627 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGCATCTGTGTGTAAGAC -3'
(R):5'- ACAGTGAGGGAGACATCTCA -3'

Sequencing Primer
(F):5'- GCATCTGTGTGTAAGACTATATTGCC -3'
(R):5'- ACACACAGTCAGTAAGATGTGC -3'
Posted On2018-05-21