Incidental Mutation 'R6466:Chrm1'
ID516610
Institutional Source Beutler Lab
Gene Symbol Chrm1
Ensembl Gene ENSMUSG00000032773
Gene Namecholinergic receptor, muscarinic 1, CNS
Synonymsmuscarinic acetylcholine receptor 1, M1R, M1, AW495047, Chrm-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6466 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8663789-8683587 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 8678178 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 82 (Y82*)
Ref Sequence ENSEMBL: ENSMUSP00000126103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035444] [ENSMUST00000163785] [ENSMUST00000177197]
Predicted Effect probably null
Transcript: ENSMUST00000035444
AA Change: Y82*
SMART Domains Protein: ENSMUSP00000042632
Gene: ENSMUSG00000032773
AA Change: Y82*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 227 1.7e-7 PFAM
Pfam:7tm_1 42 418 1.9e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157205
Predicted Effect probably null
Transcript: ENSMUST00000163785
AA Change: Y82*
SMART Domains Protein: ENSMUSP00000126103
Gene: ENSMUSG00000032773
AA Change: Y82*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 227 1.7e-7 PFAM
Pfam:7tm_1 42 418 2.9e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177197
SMART Domains Protein: ENSMUSP00000135356
Gene: ENSMUSG00000032773

DomainStartEndE-ValueType
Pfam:7tm_1 42 74 1.6e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 1 is involved in mediation of vagally-induced bronchoconstriction and in the acid secretion of the gastrointestinal tract. The gene encoding this receptor is localized to 11q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit resistance to pilocarpine-induced seizures, selective memory deficits, elevated dopaminergic transmission in the striatum, and increased spontaneous and amphetamine-induced locomotion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190005I06Rik A T 8: 120,608,996 D69E probably damaging Het
Adgrv1 G T 13: 81,575,101 probably null Het
Ahr A T 12: 35,504,032 V696E probably benign Het
Akap13 A G 7: 75,727,044 T2007A probably benign Het
Arid1b T C 17: 5,327,678 F753S probably damaging Het
BC055324 G T 1: 163,954,165 R898S probably benign Het
Bpifb3 G T 2: 153,922,188 K105N probably damaging Het
C2cd2 A G 16: 97,879,622 C331R probably benign Het
Clcn3 A C 8: 60,929,561 V331G probably damaging Het
Dchs1 A T 7: 105,764,541 D1022E probably benign Het
Dnah2 T A 11: 69,539,415 T106S probably benign Het
Fam171a2 T A 11: 102,439,885 D256V probably damaging Het
Fmn2 T A 1: 174,609,583 probably benign Het
Fut11 C T 14: 20,695,309 R103W probably damaging Het
Gas2l2 A C 11: 83,429,353 S26A probably damaging Het
Gm13178 T A 4: 144,703,867 D184V probably damaging Het
Gramd1a A T 7: 31,143,796 I29N probably benign Het
Grem2 A G 1: 174,836,884 V133A probably damaging Het
Hydin T A 8: 110,506,968 S1813T possibly damaging Het
Igkv3-2 T C 6: 70,699,039 F111L probably benign Het
Ints8 T C 4: 11,252,878 Q68R probably damaging Het
Irx5 A G 8: 92,359,726 I146V probably damaging Het
Kcnh3 T C 15: 99,238,243 L707P probably damaging Het
Kcnk4 T A 19: 6,928,297 I101F probably damaging Het
Klhl9 A G 4: 88,721,162 Y281H probably benign Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lmbr1 C T 5: 29,378,168 A9T probably benign Het
Map10 G T 8: 125,672,384 E839* probably null Het
Nectin4 C A 1: 171,386,753 A492D probably damaging Het
Nfat5 T A 8: 107,355,508 probably null Het
Olfr467 A G 7: 107,814,694 T37A probably benign Het
Plec A G 15: 76,177,884 Y2608H probably benign Het
Pold3 A G 7: 100,100,632 S42P probably benign Het
Ppp2r1a G T 17: 20,960,631 G432* probably null Het
Qk T C 17: 10,215,465 E315G probably benign Het
Rfx2 C T 17: 56,784,397 V354I probably benign Het
Rp1 T C 1: 4,347,886 Y1001C probably benign Het
Sez6l A G 5: 112,461,141 probably null Het
Slc39a14 A G 14: 70,309,886 I337T probably damaging Het
Slc3a2 G T 19: 8,709,319 L76M probably damaging Het
Slco1a5 T C 6: 142,237,534 T555A probably benign Het
Sprr2e A T 3: 92,353,034 K57N unknown Het
Syne2 A G 12: 75,943,901 T1886A probably damaging Het
Tenm3 A T 8: 48,236,063 I2147N probably damaging Het
Thbs1 G T 2: 118,119,847 G654W probably damaging Het
Tigd5 A G 15: 75,910,503 Y238C possibly damaging Het
Tmem221 A G 8: 71,557,849 F126S probably damaging Het
Trp63 C A 16: 25,763,358 P52Q probably damaging Het
Ugp2 A T 11: 21,328,883 S434R probably benign Het
Vmn2r69 A C 7: 85,407,170 F587V probably benign Het
Vps13d T A 4: 145,057,495 N3872I possibly damaging Het
Wdfy2 A G 14: 62,948,666 Y250C probably damaging Het
Zbtb16 T C 9: 48,665,319 D487G possibly damaging Het
Other mutations in Chrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Chrm1 APN 19 8678074 missense probably benign 0.01
IGL01633:Chrm1 APN 19 8678495 missense probably benign 0.29
IGL01824:Chrm1 APN 19 8679130 missense probably damaging 0.98
IGL02539:Chrm1 APN 19 8678311 missense probably damaging 1.00
IGL03342:Chrm1 APN 19 8679308 missense probably benign 0.33
R1660:Chrm1 UTSW 19 8679218 missense possibly damaging 0.53
R1942:Chrm1 UTSW 19 8678273 missense probably damaging 0.99
R2208:Chrm1 UTSW 19 8678099 missense probably damaging 1.00
R6535:Chrm1 UTSW 19 8679073 missense possibly damaging 0.93
R6720:Chrm1 UTSW 19 8678548 missense probably benign 0.00
R8061:Chrm1 UTSW 19 8679154 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTCCCAACATCACCGTCTTG -3'
(R):5'- AATCATCAGAGCTGCCCTG -3'

Sequencing Primer
(F):5'- TCTTGGCACCAGGAAAGGGTC -3'
(R):5'- GTCACTGAGAAGTAACGG -3'
Posted On2018-05-21