Incidental Mutation 'R6467:Samd4b'
ID516644
Institutional Source Beutler Lab
Gene Symbol Samd4b
Ensembl Gene ENSMUSG00000109336
Gene Namesterile alpha motif domain containing 4B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R6467 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location28399522-28598144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28401860 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 667 (S667P)
Ref Sequence ENSEMBL: ENSMUSP00000147037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003529] [ENSMUST00000040531] [ENSMUST00000207766] [ENSMUST00000208126] [ENSMUST00000208199]
Predicted Effect probably benign
Transcript: ENSMUST00000003529
SMART Domains Protein: ENSMUSP00000003529
Gene: ENSMUSG00000003437

DomainStartEndE-ValueType
Pfam:Paf1 28 441 2.3e-154 PFAM
low complexity region 456 470 N/A INTRINSIC
low complexity region 476 511 N/A INTRINSIC
low complexity region 514 535 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000040531
AA Change: S667P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336
AA Change: S667P

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146913
Predicted Effect probably benign
Transcript: ENSMUST00000207766
Predicted Effect probably damaging
Transcript: ENSMUST00000208126
AA Change: S114P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208199
AA Change: S667P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T C 15: 101,194,841 W122R possibly damaging Het
Adgrv1 C T 13: 81,444,538 R4294H probably benign Het
Afdn A G 17: 13,804,053 T74A probably damaging Het
Aff3 T A 1: 38,208,017 D829V probably benign Het
Akr1c12 T C 13: 4,275,773 Q107R probably benign Het
Apc T A 18: 34,269,199 F131I probably benign Het
Atp13a1 T A 8: 69,806,774 L1036H probably damaging Het
BC035044 A C 6: 128,890,892 probably benign Het
C1rl A G 6: 124,508,576 D302G probably benign Het
C2cd6 A C 1: 59,077,934 D133E probably benign Het
Cacna1c T A 6: 118,652,710 Y1061F probably damaging Het
Cav1 A G 6: 17,308,035 D62G probably damaging Het
Ccdc130 T C 8: 84,258,689 E317G probably benign Het
Ccdc77 T C 6: 120,350,281 M68V probably damaging Het
Cd55 A T 1: 130,447,611 probably benign Het
Cdc27 C A 11: 104,522,776 A380S probably damaging Het
Cenpb A T 2: 131,179,557 I107K probably damaging Het
Cep135 T G 5: 76,621,340 H612Q possibly damaging Het
Chd1l A T 3: 97,563,533 N815K probably damaging Het
Cldn20 C T 17: 3,532,717 T55M possibly damaging Het
Depdc1a A T 3: 159,516,042 I208L probably benign Het
Dgkb C T 12: 38,084,224 A43V possibly damaging Het
Dgkb C T 12: 38,604,105 T741I probably damaging Het
Dhx16 A G 17: 35,886,184 N653S probably damaging Het
Dnah5 T A 15: 28,438,183 S3987T probably benign Het
Dst T A 1: 34,295,196 I4835N probably damaging Het
Esrrb A G 12: 86,514,340 I288V probably damaging Het
Fam214b A T 4: 43,033,687 F489I probably damaging Het
Fnta C T 8: 26,007,313 W169* probably null Het
Golga4 T C 9: 118,536,792 L304P probably damaging Het
Hace1 A G 10: 45,590,266 probably null Het
Ino80b G T 6: 83,124,131 probably null Het
Kcmf1 G A 6: 72,843,099 R306C probably damaging Het
Lrrc46 G A 11: 97,036,479 T92I possibly damaging Het
Man2b1 T C 8: 85,097,447 V991A possibly damaging Het
Mga A G 2: 119,946,295 N1770S probably damaging Het
Mgat4e T C 1: 134,541,206 T367A probably benign Het
Mtr A G 13: 12,188,106 S1204P probably damaging Het
Myo15 G A 11: 60,526,661 probably null Het
Nktr T C 9: 121,731,519 S74P probably damaging Het
Noct T C 3: 51,250,087 V282A possibly damaging Het
Nol11 A T 11: 107,181,086 I227K possibly damaging Het
Nsd3 T A 8: 25,640,630 S4T probably damaging Het
Olfr1022 T A 2: 85,869,370 Y259* probably null Het
Olfr488 A G 7: 108,255,902 S79P probably damaging Het
Pds5a T A 5: 65,652,439 L393F probably damaging Het
Prex2 C T 1: 11,266,035 R1486C probably damaging Het
Rc3h2 T C 2: 37,382,016 T768A probably damaging Het
Rin3 A T 12: 102,369,325 E418D probably benign Het
Rnf214 G T 9: 45,867,588 T586N probably damaging Het
Sec14l2 T C 11: 4,111,161 Y100C probably damaging Het
Slc46a2 T C 4: 59,914,077 E282G probably benign Het
Themis A C 10: 28,781,766 N110T possibly damaging Het
Tln1 C A 4: 43,543,165 S1333I probably benign Het
Tmem53 T C 4: 117,268,428 V224A possibly damaging Het
Tmtc4 T A 14: 122,925,979 K664N possibly damaging Het
Tnni3k T C 3: 154,969,285 D201G probably damaging Het
Tnxb A G 17: 34,693,924 E1681G probably damaging Het
Trhde A T 10: 114,504,198 D567E probably damaging Het
Tsc2 T C 17: 24,609,127 M788V probably benign Het
Ube3a A G 7: 59,276,902 Y476C probably damaging Het
Ubiad1 T C 4: 148,436,225 N314S possibly damaging Het
Unc79 T A 12: 103,173,512 N2375K probably damaging Het
Vmn2r107 A T 17: 20,375,677 I831F probably damaging Het
Vwa3b T A 1: 37,085,286 C322S probably benign Het
Wdr78 T C 4: 103,049,561 D685G probably damaging Het
Wnk1 A T 6: 119,962,955 H238Q probably benign Het
Wnk2 A G 13: 49,146,605 Y210H probably damaging Het
Wwc2 T C 8: 47,851,908 D894G unknown Het
Yes1 T A 5: 32,653,037 F180Y probably damaging Het
Zbtb46 T C 2: 181,391,269 Y533C probably damaging Het
Zfp57 T C 17: 37,006,050 S7P possibly damaging Het
Zzef1 T C 11: 72,911,264 probably null Het
Other mutations in Samd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Samd4b APN 7 28401877 missense probably damaging 1.00
IGL00979:Samd4b APN 7 28414213 missense probably damaging 1.00
IGL01336:Samd4b APN 7 28413963 missense probably benign 0.00
IGL01432:Samd4b APN 7 28414066 missense possibly damaging 0.60
IGL01895:Samd4b APN 7 28401909 critical splice acceptor site probably null
IGL02827:Samd4b APN 7 28414121 missense probably damaging 1.00
IGL03077:Samd4b APN 7 28406443 missense probably damaging 0.99
IGL03055:Samd4b UTSW 7 28405546 missense possibly damaging 0.89
R0367:Samd4b UTSW 7 28423448 missense probably damaging 1.00
R0390:Samd4b UTSW 7 28403977 missense probably benign 0.13
R0440:Samd4b UTSW 7 28408160 missense probably benign 0.45
R0488:Samd4b UTSW 7 28414237 missense probably damaging 1.00
R0798:Samd4b UTSW 7 28401623 splice site probably benign
R1233:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1234:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1481:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1643:Samd4b UTSW 7 28423616 missense probably damaging 1.00
R1675:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1768:Samd4b UTSW 7 28413892 missense probably benign 0.36
R1801:Samd4b UTSW 7 28407331 splice site probably null
R2831:Samd4b UTSW 7 28403913 missense probably damaging 0.99
R4505:Samd4b UTSW 7 28407500 missense probably benign 0.15
R4507:Samd4b UTSW 7 28407500 missense probably benign 0.15
R4731:Samd4b UTSW 7 28406663 missense probably benign 0.00
R5811:Samd4b UTSW 7 28408020 missense probably damaging 1.00
R6063:Samd4b UTSW 7 28423631 start codon destroyed possibly damaging 0.71
R6114:Samd4b UTSW 7 28522792 unclassified probably null
R6356:Samd4b UTSW 7 28401593 missense probably damaging 1.00
R7055:Samd4b UTSW 7 28404033 missense probably benign 0.01
R7191:Samd4b UTSW 7 28414261 missense probably benign 0.18
R7371:Samd4b UTSW 7 28423501 missense probably benign 0.33
R7445:Samd4b UTSW 7 28406456 missense probably benign 0.00
R7543:Samd4b UTSW 7 28414286 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACATAGCATGTCATCCCAGG -3'
(R):5'- ACATCCCTAGGCCTGTGTTTG -3'

Sequencing Primer
(F):5'- ATGTCATCCCAGGCAGGC -3'
(R):5'- CCCTTGTATGCATGCTTTCTGGG -3'
Posted On2018-05-21