Incidental Mutation 'R6467:Atp13a1'
ID516650
Institutional Source Beutler Lab
Gene Symbol Atp13a1
Ensembl Gene ENSMUSG00000031862
Gene NameATPase type 13A1
SynonymsCgi152, Atp13a, catp
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_133224.2; MGI: 2180801

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6467 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location69791163-69807749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69806774 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 1036 (L1036H)
Ref Sequence ENSEMBL: ENSMUSP00000034326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034326] [ENSMUST00000036074] [ENSMUST00000123453]
Predicted Effect probably damaging
Transcript: ENSMUST00000034326
AA Change: L1036H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034326
Gene: ENSMUSG00000031862
AA Change: L1036H

DomainStartEndE-ValueType
low complexity region 54 62 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Pfam:E1-E2_ATPase 264 515 3.2e-24 PFAM
Pfam:Hydrolase 524 781 2.2e-11 PFAM
Pfam:HAD 527 870 2.7e-27 PFAM
low complexity region 883 894 N/A INTRINSIC
transmembrane domain 1045 1067 N/A INTRINSIC
transmembrane domain 1093 1115 N/A INTRINSIC
transmembrane domain 1130 1147 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036074
SMART Domains Protein: ENSMUSP00000045676
Gene: ENSMUSG00000036246

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-149 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Blast:RhoGAP 824 971 1e-53 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123453
SMART Domains Protein: ENSMUSP00000116542
Gene: ENSMUSG00000036246

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-150 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156620
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (72/73)
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T C 15: 101,194,841 W122R possibly damaging Het
Adgrv1 C T 13: 81,444,538 R4294H probably benign Het
Afdn A G 17: 13,804,053 T74A probably damaging Het
Aff3 T A 1: 38,208,017 D829V probably benign Het
Akr1c12 T C 13: 4,275,773 Q107R probably benign Het
Apc T A 18: 34,269,199 F131I probably benign Het
BC035044 A C 6: 128,890,892 probably benign Het
C1rl A G 6: 124,508,576 D302G probably benign Het
C2cd6 A C 1: 59,077,934 D133E probably benign Het
Cacna1c T A 6: 118,652,710 Y1061F probably damaging Het
Cav1 A G 6: 17,308,035 D62G probably damaging Het
Ccdc130 T C 8: 84,258,689 E317G probably benign Het
Ccdc77 T C 6: 120,350,281 M68V probably damaging Het
Cd55 A T 1: 130,447,611 probably benign Het
Cdc27 C A 11: 104,522,776 A380S probably damaging Het
Cenpb A T 2: 131,179,557 I107K probably damaging Het
Cep135 T G 5: 76,621,340 H612Q possibly damaging Het
Chd1l A T 3: 97,563,533 N815K probably damaging Het
Cldn20 C T 17: 3,532,717 T55M possibly damaging Het
Depdc1a A T 3: 159,516,042 I208L probably benign Het
Dgkb C T 12: 38,084,224 A43V possibly damaging Het
Dgkb C T 12: 38,604,105 T741I probably damaging Het
Dhx16 A G 17: 35,886,184 N653S probably damaging Het
Dnah5 T A 15: 28,438,183 S3987T probably benign Het
Dst T A 1: 34,295,196 I4835N probably damaging Het
Esrrb A G 12: 86,514,340 I288V probably damaging Het
Fam214b A T 4: 43,033,687 F489I probably damaging Het
Fnta C T 8: 26,007,313 W169* probably null Het
Golga4 T C 9: 118,536,792 L304P probably damaging Het
Hace1 A G 10: 45,590,266 probably null Het
Ino80b G T 6: 83,124,131 probably null Het
Kcmf1 G A 6: 72,843,099 R306C probably damaging Het
Lrrc46 G A 11: 97,036,479 T92I possibly damaging Het
Man2b1 T C 8: 85,097,447 V991A possibly damaging Het
Mga A G 2: 119,946,295 N1770S probably damaging Het
Mgat4e T C 1: 134,541,206 T367A probably benign Het
Mtr A G 13: 12,188,106 S1204P probably damaging Het
Myo15 G A 11: 60,526,661 probably null Het
Nktr T C 9: 121,731,519 S74P probably damaging Het
Noct T C 3: 51,250,087 V282A possibly damaging Het
Nol11 A T 11: 107,181,086 I227K possibly damaging Het
Nsd3 T A 8: 25,640,630 S4T probably damaging Het
Olfr1022 T A 2: 85,869,370 Y259* probably null Het
Olfr488 A G 7: 108,255,902 S79P probably damaging Het
Pds5a T A 5: 65,652,439 L393F probably damaging Het
Prex2 C T 1: 11,266,035 R1486C probably damaging Het
Rc3h2 T C 2: 37,382,016 T768A probably damaging Het
Rin3 A T 12: 102,369,325 E418D probably benign Het
Rnf214 G T 9: 45,867,588 T586N probably damaging Het
Samd4b A G 7: 28,401,860 S667P probably damaging Het
Sec14l2 T C 11: 4,111,161 Y100C probably damaging Het
Slc46a2 T C 4: 59,914,077 E282G probably benign Het
Themis A C 10: 28,781,766 N110T possibly damaging Het
Tln1 C A 4: 43,543,165 S1333I probably benign Het
Tmem53 T C 4: 117,268,428 V224A possibly damaging Het
Tmtc4 T A 14: 122,925,979 K664N possibly damaging Het
Tnni3k T C 3: 154,969,285 D201G probably damaging Het
Tnxb A G 17: 34,693,924 E1681G probably damaging Het
Trhde A T 10: 114,504,198 D567E probably damaging Het
Tsc2 T C 17: 24,609,127 M788V probably benign Het
Ube3a A G 7: 59,276,902 Y476C probably damaging Het
Ubiad1 T C 4: 148,436,225 N314S possibly damaging Het
Unc79 T A 12: 103,173,512 N2375K probably damaging Het
Vmn2r107 A T 17: 20,375,677 I831F probably damaging Het
Vwa3b T A 1: 37,085,286 C322S probably benign Het
Wdr78 T C 4: 103,049,561 D685G probably damaging Het
Wnk1 A T 6: 119,962,955 H238Q probably benign Het
Wnk2 A G 13: 49,146,605 Y210H probably damaging Het
Wwc2 T C 8: 47,851,908 D894G unknown Het
Yes1 T A 5: 32,653,037 F180Y probably damaging Het
Zbtb46 T C 2: 181,391,269 Y533C probably damaging Het
Zfp57 T C 17: 37,006,050 S7P possibly damaging Het
Zzef1 T C 11: 72,911,264 probably null Het
Other mutations in Atp13a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Atp13a1 APN 8 69796897 missense probably damaging 1.00
IGL00949:Atp13a1 APN 8 69800003 splice site probably benign
IGL01122:Atp13a1 APN 8 69798905 missense probably damaging 1.00
IGL02399:Atp13a1 APN 8 69807101 missense probably damaging 1.00
IGL02616:Atp13a1 APN 8 69805313 missense probably benign
IGL03073:Atp13a1 APN 8 69798502 missense probably damaging 1.00
yun_nan UTSW 8 69798679 missense probably damaging 1.00
P0005:Atp13a1 UTSW 8 69803747 missense possibly damaging 0.88
R0086:Atp13a1 UTSW 8 69797774 missense possibly damaging 0.86
R0384:Atp13a1 UTSW 8 69797324 missense possibly damaging 0.89
R0973:Atp13a1 UTSW 8 69802144 critical splice donor site probably null
R0973:Atp13a1 UTSW 8 69802144 critical splice donor site probably null
R0974:Atp13a1 UTSW 8 69802144 critical splice donor site probably null
R2010:Atp13a1 UTSW 8 69791360 missense possibly damaging 0.77
R2040:Atp13a1 UTSW 8 69807052 missense possibly damaging 0.76
R2069:Atp13a1 UTSW 8 69799773 missense probably benign 0.00
R4274:Atp13a1 UTSW 8 69805292 missense probably benign
R4288:Atp13a1 UTSW 8 69794078 missense possibly damaging 0.89
R4470:Atp13a1 UTSW 8 69798679 missense probably damaging 1.00
R5408:Atp13a1 UTSW 8 69796840 missense probably benign 0.41
R5916:Atp13a1 UTSW 8 69807098 missense probably damaging 1.00
R5920:Atp13a1 UTSW 8 69800096 missense probably benign 0.02
R5951:Atp13a1 UTSW 8 69797285 missense probably damaging 1.00
R6143:Atp13a1 UTSW 8 69805360 missense probably benign
R6487:Atp13a1 UTSW 8 69799878 missense probably damaging 0.99
R7166:Atp13a1 UTSW 8 69799316 splice site probably null
R7652:Atp13a1 UTSW 8 69805559 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAAGGCTCTGATTGCATTTGTG -3'
(R):5'- TACAAACTGCTCCTGCCTG -3'

Sequencing Primer
(F):5'- TGGGAATAGAGAGTAAATCTGTCTCC -3'
(R):5'- AGGCACCCACTGTAGCTTC -3'
Posted On2018-05-21