Mutagenetix > Incidental Mutation

Incidental Mutation 'R6467:Golga4'

516654

Institutional Source

Beutler Lab

Gene Symbol

Golga4

Ensembl Gene

ENSMUSG00000038708

Gene Name

golgi autoantigen, golgin subfamily a, 4

Synonyms

golgin-245, Olp-1

MMRRC Submission

Accession Numbers

Genbank: NM_018748; MGI: 1859646

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6467 (G1)

Quality Score

210.009

Status

Validated

Chromosome

Chromosomal Location

118506267-118582519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118536792 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 304 (L304P)

Ref Sequence

ENSEMBL: ENSMUSP00000148748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097] [ENSMUST00000212461]

AlphaFold

Q91VW5

Predicted Effect

probably damaging
Transcript: ENSMUST00000084820
AA Change: L304P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: L304P

Domain	Start	End	E-Value	Type
low complexity region	10	41	N/A	INTRINSIC
coiled coil region	157	241	N/A	INTRINSIC
internal_repeat_1	271	299	2.93e-5	PROSPERO
low complexity region	339	351	N/A	INTRINSIC
low complexity region	513	532	N/A	INTRINSIC
low complexity region	547	566	N/A	INTRINSIC
low complexity region	705	715	N/A	INTRINSIC
low complexity region	739	755	N/A	INTRINSIC
low complexity region	882	895	N/A	INTRINSIC
SCOP:d1epua_	940	1076	2e-3	SMART
low complexity region	1138	1152	N/A	INTRINSIC
low complexity region	1161	1182	N/A	INTRINSIC
low complexity region	1204	1228	N/A	INTRINSIC
coiled coil region	1283	1496	N/A	INTRINSIC
internal_repeat_2	1500	1525	5.98e-5	PROSPERO
coiled coil region	1541	1715	N/A	INTRINSIC
low complexity region	1756	1778	N/A	INTRINSIC
internal_repeat_1	1811	1839	2.93e-5	PROSPERO
coiled coil region	1844	1883	N/A	INTRINSIC
internal_repeat_2	1899	1924	5.98e-5	PROSPERO
coiled coil region	1933	2160	N/A	INTRINSIC
Grip	2181	2225	1.38e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000212097
AA Change: L304P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000212183

Predicted Effect

probably damaging
Transcript: ENSMUST00000212461
AA Change: L313P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212593

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]

Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acvr1b	T	C	15: 101,194,841	W122R	possibly damaging	Het
Adgrv1	C	T	13: 81,444,538	R4294H	probably benign	Het
Afdn	A	G	17: 13,804,053	T74A	probably damaging	Het
Aff3	T	A	1: 38,208,017	D829V	probably benign	Het
Akr1c12	T	C	13: 4,275,773	Q107R	probably benign	Het
Apc	T	A	18: 34,269,199	F131I	probably benign	Het
Atp13a1	T	A	8: 69,806,774	L1036H	probably damaging	Het
BC035044	A	C	6: 128,890,892		probably benign	Het
C1rl	A	G	6: 124,508,576	D302G	probably benign	Het
C2cd6	A	C	1: 59,077,934	D133E	probably benign	Het
Cacna1c	T	A	6: 118,652,710	Y1061F	probably damaging	Het
Cav1	A	G	6: 17,308,035	D62G	probably damaging	Het
Ccdc130	T	C	8: 84,258,689	E317G	probably benign	Het
Ccdc77	T	C	6: 120,350,281	M68V	probably damaging	Het
Cd55	A	T	1: 130,447,611		probably benign	Het
Cdc27	C	A	11: 104,522,776	A380S	probably damaging	Het
Cenpb	A	T	2: 131,179,557	I107K	probably damaging	Het
Cep135	T	G	5: 76,621,340	H612Q	possibly damaging	Het
Chd1l	A	T	3: 97,563,533	N815K	probably damaging	Het
Cldn20	C	T	17: 3,532,717	T55M	possibly damaging	Het
Depdc1a	A	T	3: 159,516,042	I208L	probably benign	Het
Dgkb	C	T	12: 38,084,224	A43V	possibly damaging	Het
Dgkb	C	T	12: 38,604,105	T741I	probably damaging	Het
Dhx16	A	G	17: 35,886,184	N653S	probably damaging	Het
Dnah5	T	A	15: 28,438,183	S3987T	probably benign	Het
Dst	T	A	1: 34,295,196	I4835N	probably damaging	Het
Esrrb	A	G	12: 86,514,340	I288V	probably damaging	Het
Fam214b	A	T	4: 43,033,687	F489I	probably damaging	Het
Fnta	C	T	8: 26,007,313	W169*	probably null	Het
Hace1	A	G	10: 45,590,266		probably null	Het
Ino80b	G	T	6: 83,124,131		probably null	Het
Kcmf1	G	A	6: 72,843,099	R306C	probably damaging	Het
Lrrc46	G	A	11: 97,036,479	T92I	possibly damaging	Het
Man2b1	T	C	8: 85,097,447	V991A	possibly damaging	Het
Mga	A	G	2: 119,946,295	N1770S	probably damaging	Het
Mgat4e	T	C	1: 134,541,206	T367A	probably benign	Het
Mtr	A	G	13: 12,188,106	S1204P	probably damaging	Het
Myo15	G	A	11: 60,526,661		probably null	Het
Nktr	T	C	9: 121,731,519	S74P	probably damaging	Het
Noct	T	C	3: 51,250,087	V282A	possibly damaging	Het
Nol11	A	T	11: 107,181,086	I227K	possibly damaging	Het
Nsd3	T	A	8: 25,640,630	S4T	probably damaging	Het
Olfr1022	T	A	2: 85,869,370	Y259*	probably null	Het
Olfr488	A	G	7: 108,255,902	S79P	probably damaging	Het
Pds5a	T	A	5: 65,652,439	L393F	probably damaging	Het
Prex2	C	T	1: 11,266,035	R1486C	probably damaging	Het
Rc3h2	T	C	2: 37,382,016	T768A	probably damaging	Het
Rin3	A	T	12: 102,369,325	E418D	probably benign	Het
Rnf214	G	T	9: 45,867,588	T586N	probably damaging	Het
Samd4b	A	G	7: 28,401,860	S667P	probably damaging	Het
Sec14l2	T	C	11: 4,111,161	Y100C	probably damaging	Het
Slc46a2	T	C	4: 59,914,077	E282G	probably benign	Het
Themis	A	C	10: 28,781,766	N110T	possibly damaging	Het
Tln1	C	A	4: 43,543,165	S1333I	probably benign	Het
Tmem53	T	C	4: 117,268,428	V224A	possibly damaging	Het
Tmtc4	T	A	14: 122,925,979	K664N	possibly damaging	Het
Tnni3k	T	C	3: 154,969,285	D201G	probably damaging	Het
Tnxb	A	G	17: 34,693,924	E1681G	probably damaging	Het
Trhde	A	T	10: 114,504,198	D567E	probably damaging	Het
Tsc2	T	C	17: 24,609,127	M788V	probably benign	Het
Ube3a	A	G	7: 59,276,902	Y476C	probably damaging	Het
Ubiad1	T	C	4: 148,436,225	N314S	possibly damaging	Het
Unc79	T	A	12: 103,173,512	N2375K	probably damaging	Het
Vmn2r107	A	T	17: 20,375,677	I831F	probably damaging	Het
Vwa3b	T	A	1: 37,085,286	C322S	probably benign	Het
Wdr78	T	C	4: 103,049,561	D685G	probably damaging	Het
Wnk1	A	T	6: 119,962,955	H238Q	probably benign	Het
Wnk2	A	G	13: 49,146,605	Y210H	probably damaging	Het
Wwc2	T	C	8: 47,851,908	D894G	unknown	Het
Yes1	T	A	5: 32,653,037	F180Y	probably damaging	Het
Zbtb46	T	C	2: 181,391,269	Y533C	probably damaging	Het
Zfp57	T	C	17: 37,006,050	S7P	possibly damaging	Het
Zzef1	T	C	11: 72,911,264		probably null	Het

Other mutations in Golga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00711:Golga4	APN	9	118514271	critical splice donor site	probably null
IGL00801:Golga4	APN	9	118538926	missense	probably damaging	0.98
IGL01395:Golga4	APN	9	118535373	missense	probably damaging	1.00
IGL01472:Golga4	APN	9	118532574	missense	probably damaging	1.00
IGL01519:Golga4	APN	9	118527092	missense	probably damaging	1.00
IGL01563:Golga4	APN	9	118527006	splice site	probably benign
IGL02593:Golga4	APN	9	118555566	unclassified	probably benign
IGL02803:Golga4	APN	9	118535460	missense	probably benign
IGL02939:Golga4	APN	9	118535454	missense	probably benign	0.01
IGL02939:Golga4	APN	9	118534632	missense	probably damaging	1.00
IGL03123:Golga4	APN	9	118536885	missense	probably damaging	1.00
IGL03334:Golga4	APN	9	118537233	splice site	probably benign
F5770:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62
F6893:Golga4	UTSW	9	118553457	missense	probably damaging	1.00
PIT4382001:Golga4	UTSW	9	118553453	missense	possibly damaging	0.88
R0179:Golga4	UTSW	9	118560740	critical splice acceptor site	probably null
R0279:Golga4	UTSW	9	118568993	missense	probably benign	0.00
R0362:Golga4	UTSW	9	118555785	missense	probably benign	0.13
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0974:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R1128:Golga4	UTSW	9	118548784	missense	probably benign	0.40
R1384:Golga4	UTSW	9	118565651	missense	probably damaging	0.99
R1435:Golga4	UTSW	9	118535440	missense	probably benign	0.00
R1513:Golga4	UTSW	9	118555732	missense	probably benign	0.02
R1818:Golga4	UTSW	9	118572987	missense	probably damaging	1.00
R2083:Golga4	UTSW	9	118532590	missense	probably damaging	1.00
R2243:Golga4	UTSW	9	118556904	missense	probably benign	0.06
R2355:Golga4	UTSW	9	118560742	missense	probably benign	0.00
R2518:Golga4	UTSW	9	118556612	missense	probably damaging	1.00
R2921:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2922:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2923:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R3121:Golga4	UTSW	9	118557380	missense	possibly damaging	0.68
R3424:Golga4	UTSW	9	118534647	missense	probably benign	0.16
R3909:Golga4	UTSW	9	118558736	missense	possibly damaging	0.82
R3913:Golga4	UTSW	9	118538971	missense	probably damaging	0.99
R4321:Golga4	UTSW	9	118556435	missense	probably damaging	1.00
R4358:Golga4	UTSW	9	118551878	missense	probably benign	0.16
R4483:Golga4	UTSW	9	118514186	missense	probably damaging	1.00
R4515:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4518:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4519:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4545:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4546:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4580:Golga4	UTSW	9	118557259	missense	probably benign	0.00
R4918:Golga4	UTSW	9	118558145	missense	probably damaging	1.00
R5007:Golga4	UTSW	9	118558300	missense	probably benign
R5045:Golga4	UTSW	9	118565656	missense	probably benign
R5232:Golga4	UTSW	9	118506558	critical splice donor site	probably null
R5256:Golga4	UTSW	9	118556501	missense	possibly damaging	0.93
R5502:Golga4	UTSW	9	118559057	nonsense	probably null
R5567:Golga4	UTSW	9	118558183	missense	probably damaging	1.00
R5576:Golga4	UTSW	9	118553534	missense	probably benign	0.13
R5771:Golga4	UTSW	9	118558283	missense	probably damaging	0.96
R5807:Golga4	UTSW	9	118527130	missense	probably damaging	0.99
R5860:Golga4	UTSW	9	118558106	missense	probably damaging	1.00
R6012:Golga4	UTSW	9	118559696	missense	possibly damaging	0.90
R6285:Golga4	UTSW	9	118558627	nonsense	probably null
R6299:Golga4	UTSW	9	118557370	missense	probably benign	0.03
R6552:Golga4	UTSW	9	118514231	missense	probably damaging	1.00
R6688:Golga4	UTSW	9	118514210	missense	possibly damaging	0.66
R6965:Golga4	UTSW	9	118548779	missense	probably damaging	1.00
R6987:Golga4	UTSW	9	118558532	missense	probably benign
R7212:Golga4	UTSW	9	118536840	missense	possibly damaging	0.80
R7426:Golga4	UTSW	9	118559495	missense	probably benign
R7431:Golga4	UTSW	9	118559731	missense	probably damaging	1.00
R7641:Golga4	UTSW	9	118557575	missense	probably benign	0.05
R7727:Golga4	UTSW	9	118548702	missense	probably damaging	1.00
R7729:Golga4	UTSW	9	118556063	missense	possibly damaging	0.51
R7811:Golga4	UTSW	9	118532575	missense	probably damaging	1.00
R7849:Golga4	UTSW	9	118559311	missense	possibly damaging	0.93
R7891:Golga4	UTSW	9	118556366	missense	probably damaging	1.00
R7976:Golga4	UTSW	9	118536768	missense	possibly damaging	0.49
R8275:Golga4	UTSW	9	118532559	missense	probably damaging	1.00
R8378:Golga4	UTSW	9	118558322	missense	probably benign	0.03
R8514:Golga4	UTSW	9	118555796	missense	possibly damaging	0.47
R8698:Golga4	UTSW	9	118555961	missense	probably damaging	0.97
R8856:Golga4	UTSW	9	118556711	missense	probably damaging	0.98
R9227:Golga4	UTSW	9	118556873	missense	possibly damaging	0.94
R9282:Golga4	UTSW	9	118556825	missense	probably damaging	1.00
RF022:Golga4	UTSW	9	118557989	missense	probably damaging	1.00
V7583:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CTGTTGGCAGAGTTCCTTGTAAC -3'
(R):5'- ACACTCACAGAGCAGAGGTC -3'

Sequencing Primer
(F):5'- GCAGAGTTCCTTGTAACCCTTAGG -3'
(R):5'- AGCAGAGGTCAGCTGTCTCTTAC -3'

Posted On

2018-05-21