Incidental Mutation 'R6467:Adgrv1'
ID 516673
Institutional Source Beutler Lab
Gene Symbol Adgrv1
Ensembl Gene ENSMUSG00000069170
Gene Name adhesion G protein-coupled receptor V1
Synonyms Mass1, Mgr1, VLGR1, Gpr98
MMRRC Submission 044600-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6467 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 81243187-81781273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 81592657 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 4294 (R4294H)
Ref Sequence ENSEMBL: ENSMUSP00000093245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095585]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000095585
AA Change: R4294H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000093245
Gene: ENSMUSG00000069170
AA Change: R4294H

DomainStartEndE-ValueType
Calx_beta 20 116 1.53e-1 SMART
Calx_beta 132 236 1.58e-2 SMART
Calx_beta 251 362 2.33e-2 SMART
Pfam:Calx-beta 380 489 1.1e-3 PFAM
Pfam:Calx-beta 507 616 2.5e-2 PFAM
Pfam:Calx-beta 667 747 9.1e-4 PFAM
Calx_beta 764 862 1.55e-1 SMART
Calx_beta 877 980 1.07e-1 SMART
Calx_beta 994 1094 6.45e-5 SMART
Pfam:Calx-beta 1108 1208 7.4e-4 PFAM
Pfam:Laminin_G_3 1331 1492 4.4e-24 PFAM
Pfam:Calx-beta 1498 1542 6.5e-3 PFAM
Pfam:Calx-beta 1557 1662 1e-6 PFAM
Calx_beta 1706 1805 1.34e-11 SMART
Calx_beta 1846 1948 1.04e-2 SMART
Calx_beta 1962 2075 1.59e-3 SMART
Calx_beta 2103 2202 1.59e-4 SMART
Calx_beta 2218 2320 1.74e-3 SMART
Pfam:Calx-beta 2467 2539 2.1e-4 PFAM
Calx_beta 2576 2672 1.24e-6 SMART
Calx_beta 2687 2786 1.12e-1 SMART
Calx_beta 2810 2921 2.21e-2 SMART
Calx_beta 2945 3044 6.69e-12 SMART
Pfam:Calx-beta 3063 3168 1.2e-5 PFAM
Pfam:Calx-beta 3198 3252 1.2e-1 PFAM
Pfam:EPTP 3391 3434 2.8e-10 PFAM
Pfam:Calx-beta 3577 3623 6.5e-8 PFAM
Pfam:Calx-beta 3637 3737 6e-4 PFAM
Pfam:Calx-beta 3781 3872 6.9e-3 PFAM
Calx_beta 3919 4003 1.18e-2 SMART
Calx_beta 4017 4120 5.44e-2 SMART
Pfam:Calx-beta 4193 4236 2.3e-2 PFAM
Calx_beta 4251 4351 1.43e-20 SMART
Calx_beta 4384 4484 9.46e-3 SMART
Pfam:Calx-beta 4498 4608 2e-2 PFAM
Pfam:Calx-beta 4659 4729 5.1e-2 PFAM
Calx_beta 4989 5089 5.7e-6 SMART
Pfam:Calx-beta 5229 5326 1.9e-6 PFAM
Pfam:Calx-beta 5489 5592 7.2e-5 PFAM
low complexity region 5637 5648 N/A INTRINSIC
GPS 5845 5895 9.48e-3 SMART
Pfam:7tm_2 5902 6141 2.3e-16 PFAM
low complexity region 6227 6240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125698
SMART Domains Protein: ENSMUSP00000120136
Gene: ENSMUSG00000069170

DomainStartEndE-ValueType
Pfam:Calx-beta 1 47 2e-9 PFAM
Pfam:Calx-beta 79 180 4e-11 PFAM
Pfam:Calx-beta 194 304 9.2e-4 PFAM
Pfam:Calx-beta 354 425 2.9e-3 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous and a targeted mutation exhibit high sensitivity to audiogenic seizures. Targeted mutant mice lack the ankle links that connect growing stereocilia in the developing cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1b T C 15: 101,092,722 (GRCm39) W122R possibly damaging Het
Afdn A G 17: 14,024,315 (GRCm39) T74A probably damaging Het
Aff3 T A 1: 38,247,098 (GRCm39) D829V probably benign Het
Akr1c12 T C 13: 4,325,772 (GRCm39) Q107R probably benign Het
Apc T A 18: 34,402,252 (GRCm39) F131I probably benign Het
Atosb A T 4: 43,033,687 (GRCm39) F489I probably damaging Het
Atp13a1 T A 8: 70,259,424 (GRCm39) L1036H probably damaging Het
BC035044 A C 6: 128,867,855 (GRCm39) probably benign Het
C1rl A G 6: 124,485,535 (GRCm39) D302G probably benign Het
C2cd6 A C 1: 59,117,093 (GRCm39) D133E probably benign Het
Cacna1c T A 6: 118,629,671 (GRCm39) Y1061F probably damaging Het
Cav1 A G 6: 17,308,034 (GRCm39) D62G probably damaging Het
Ccdc77 T C 6: 120,327,242 (GRCm39) M68V probably damaging Het
Cd55 A T 1: 130,375,348 (GRCm39) probably benign Het
Cdc27 C A 11: 104,413,602 (GRCm39) A380S probably damaging Het
Cenpb A T 2: 131,021,477 (GRCm39) I107K probably damaging Het
Cep135 T G 5: 76,769,187 (GRCm39) H612Q possibly damaging Het
Chd1l A T 3: 97,470,849 (GRCm39) N815K probably damaging Het
Cldn20 C T 17: 3,582,992 (GRCm39) T55M possibly damaging Het
Depdc1a A T 3: 159,221,679 (GRCm39) I208L probably benign Het
Dgkb C T 12: 38,134,223 (GRCm39) A43V possibly damaging Het
Dgkb C T 12: 38,654,104 (GRCm39) T741I probably damaging Het
Dhx16 A G 17: 36,197,076 (GRCm39) N653S probably damaging Het
Dnah5 T A 15: 28,438,329 (GRCm39) S3987T probably benign Het
Dnai4 T C 4: 102,906,758 (GRCm39) D685G probably damaging Het
Dst T A 1: 34,334,277 (GRCm39) I4835N probably damaging Het
Esrrb A G 12: 86,561,114 (GRCm39) I288V probably damaging Het
Fnta C T 8: 26,497,341 (GRCm39) W169* probably null Het
Golga4 T C 9: 118,365,860 (GRCm39) L304P probably damaging Het
Hace1 A G 10: 45,466,362 (GRCm39) probably null Het
Ino80b G T 6: 83,101,112 (GRCm39) probably null Het
Kcmf1 G A 6: 72,820,082 (GRCm39) R306C probably damaging Het
Lrrc46 G A 11: 96,927,305 (GRCm39) T92I possibly damaging Het
Man2b1 T C 8: 85,824,076 (GRCm39) V991A possibly damaging Het
Mga A G 2: 119,776,776 (GRCm39) N1770S probably damaging Het
Mgat4e T C 1: 134,468,944 (GRCm39) T367A probably benign Het
Mtr A G 13: 12,202,992 (GRCm39) S1204P probably damaging Het
Myo15a G A 11: 60,417,487 (GRCm39) probably null Het
Nktr T C 9: 121,560,585 (GRCm39) S74P probably damaging Het
Noct T C 3: 51,157,508 (GRCm39) V282A possibly damaging Het
Nol11 A T 11: 107,071,912 (GRCm39) I227K possibly damaging Het
Nsd3 T A 8: 26,130,646 (GRCm39) S4T probably damaging Het
Or5m10b T A 2: 85,699,714 (GRCm39) Y259* probably null Het
Or5p64 A G 7: 107,855,109 (GRCm39) S79P probably damaging Het
Pds5a T A 5: 65,809,782 (GRCm39) L393F probably damaging Het
Prex2 C T 1: 11,336,259 (GRCm39) R1486C probably damaging Het
Rc3h2 T C 2: 37,272,028 (GRCm39) T768A probably damaging Het
Rin3 A T 12: 102,335,584 (GRCm39) E418D probably benign Het
Rnf214 G T 9: 45,778,886 (GRCm39) T586N probably damaging Het
Samd4b A G 7: 28,101,285 (GRCm39) S667P probably damaging Het
Sec14l2 T C 11: 4,061,161 (GRCm39) Y100C probably damaging Het
Slc46a2 T C 4: 59,914,077 (GRCm39) E282G probably benign Het
Themis A C 10: 28,657,762 (GRCm39) N110T possibly damaging Het
Tln1 C A 4: 43,543,165 (GRCm39) S1333I probably benign Het
Tmem53 T C 4: 117,125,625 (GRCm39) V224A possibly damaging Het
Tmtc4 T A 14: 123,163,391 (GRCm39) K664N possibly damaging Het
Tnni3k T C 3: 154,674,922 (GRCm39) D201G probably damaging Het
Tnxb A G 17: 34,912,898 (GRCm39) E1681G probably damaging Het
Trhde A T 10: 114,340,103 (GRCm39) D567E probably damaging Het
Tsc2 T C 17: 24,828,101 (GRCm39) M788V probably benign Het
Ube3a A G 7: 58,926,650 (GRCm39) Y476C probably damaging Het
Ubiad1 T C 4: 148,520,682 (GRCm39) N314S possibly damaging Het
Unc79 T A 12: 103,139,771 (GRCm39) N2375K probably damaging Het
Vmn2r107 A T 17: 20,595,939 (GRCm39) I831F probably damaging Het
Vwa3b T A 1: 37,124,367 (GRCm39) C322S probably benign Het
Wnk1 A T 6: 119,939,916 (GRCm39) H238Q probably benign Het
Wnk2 A G 13: 49,300,081 (GRCm39) Y210H probably damaging Het
Wwc2 T C 8: 48,304,943 (GRCm39) D894G unknown Het
Yes1 T A 5: 32,810,381 (GRCm39) F180Y probably damaging Het
Yju2b T C 8: 84,985,318 (GRCm39) E317G probably benign Het
Zbtb46 T C 2: 181,033,062 (GRCm39) Y533C probably damaging Het
Zfp57 T C 17: 37,316,942 (GRCm39) S7P possibly damaging Het
Zzef1 T C 11: 72,802,090 (GRCm39) probably null Het
Other mutations in Adgrv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgrv1 APN 13 81,553,527 (GRCm39) critical splice acceptor site probably null
IGL00090:Adgrv1 APN 13 81,726,220 (GRCm39) missense probably damaging 1.00
IGL00091:Adgrv1 APN 13 81,726,220 (GRCm39) missense probably damaging 1.00
IGL00332:Adgrv1 APN 13 81,620,996 (GRCm39) splice site probably benign
IGL00471:Adgrv1 APN 13 81,657,661 (GRCm39) missense probably damaging 0.99
IGL00476:Adgrv1 APN 13 81,637,193 (GRCm39) missense probably damaging 0.98
IGL00508:Adgrv1 APN 13 81,654,306 (GRCm39) missense probably damaging 1.00
IGL00727:Adgrv1 APN 13 81,672,803 (GRCm39) missense probably damaging 0.98
IGL00781:Adgrv1 APN 13 81,726,349 (GRCm39) missense probably benign 0.19
IGL00816:Adgrv1 APN 13 81,545,322 (GRCm39) missense probably benign 0.01
IGL00844:Adgrv1 APN 13 81,688,238 (GRCm39) missense probably damaging 1.00
IGL00923:Adgrv1 APN 13 81,530,410 (GRCm39) missense probably damaging 0.99
IGL01113:Adgrv1 APN 13 81,637,147 (GRCm39) missense probably benign 0.00
IGL01143:Adgrv1 APN 13 81,567,470 (GRCm39) missense probably benign 0.00
IGL01151:Adgrv1 APN 13 81,553,518 (GRCm39) missense probably benign 0.00
IGL01153:Adgrv1 APN 13 81,567,247 (GRCm39) missense probably benign 0.01
IGL01363:Adgrv1 APN 13 81,705,184 (GRCm39) missense probably damaging 1.00
IGL01419:Adgrv1 APN 13 81,705,277 (GRCm39) missense probably damaging 0.99
IGL01545:Adgrv1 APN 13 81,614,303 (GRCm39) missense possibly damaging 0.46
IGL01701:Adgrv1 APN 13 81,567,750 (GRCm39) missense possibly damaging 0.55
IGL01796:Adgrv1 APN 13 81,715,461 (GRCm39) missense probably benign 0.01
IGL01816:Adgrv1 APN 13 81,677,168 (GRCm39) missense probably benign 0.00
IGL01871:Adgrv1 APN 13 81,620,513 (GRCm39) critical splice donor site probably null
IGL01955:Adgrv1 APN 13 81,330,902 (GRCm39) missense probably damaging 1.00
IGL01956:Adgrv1 APN 13 81,594,549 (GRCm39) missense possibly damaging 0.63
IGL01988:Adgrv1 APN 13 81,705,428 (GRCm39) missense probably damaging 0.99
IGL01990:Adgrv1 APN 13 81,705,115 (GRCm39) missense probably damaging 1.00
IGL02007:Adgrv1 APN 13 81,716,862 (GRCm39) splice site probably benign
IGL02016:Adgrv1 APN 13 81,545,572 (GRCm39) missense probably damaging 1.00
IGL02095:Adgrv1 APN 13 81,727,909 (GRCm39) missense possibly damaging 0.63
IGL02174:Adgrv1 APN 13 81,575,783 (GRCm39) missense probably benign 0.34
IGL02270:Adgrv1 APN 13 81,707,314 (GRCm39) splice site probably null
IGL02328:Adgrv1 APN 13 81,726,294 (GRCm39) missense probably damaging 1.00
IGL02350:Adgrv1 APN 13 81,418,974 (GRCm39) missense probably benign 0.00
IGL02357:Adgrv1 APN 13 81,418,974 (GRCm39) missense probably benign 0.00
IGL02373:Adgrv1 APN 13 81,607,832 (GRCm39) missense possibly damaging 0.90
IGL02402:Adgrv1 APN 13 81,707,543 (GRCm39) missense probably benign 0.18
IGL02407:Adgrv1 APN 13 81,627,789 (GRCm39) missense probably damaging 1.00
IGL02508:Adgrv1 APN 13 81,583,675 (GRCm39) splice site probably benign
IGL02603:Adgrv1 APN 13 81,637,071 (GRCm39) missense possibly damaging 0.93
IGL02648:Adgrv1 APN 13 81,659,738 (GRCm39) missense probably benign 0.35
IGL02720:Adgrv1 APN 13 81,726,991 (GRCm39) missense probably damaging 0.99
IGL02870:Adgrv1 APN 13 81,711,851 (GRCm39) missense probably benign 0.13
IGL02896:Adgrv1 APN 13 81,668,858 (GRCm39) missense probably damaging 1.00
IGL02931:Adgrv1 APN 13 81,727,833 (GRCm39) missense probably damaging 1.00
IGL02952:Adgrv1 APN 13 81,581,755 (GRCm39) missense probably benign 0.00
IGL02961:Adgrv1 APN 13 81,671,731 (GRCm39) missense probably damaging 1.00
IGL02999:Adgrv1 APN 13 81,726,973 (GRCm39) missense probably benign 0.12
IGL03067:Adgrv1 APN 13 81,590,599 (GRCm39) missense probably damaging 1.00
IGL03106:Adgrv1 APN 13 81,621,018 (GRCm39) missense probably benign 0.00
IGL03108:Adgrv1 APN 13 81,707,648 (GRCm39) missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81,581,819 (GRCm39) missense probably benign 0.02
IGL03119:Adgrv1 APN 13 81,530,492 (GRCm39) missense probably damaging 1.00
IGL03169:Adgrv1 APN 13 81,652,019 (GRCm39) missense probably damaging 1.00
IGL03186:Adgrv1 APN 13 81,581,737 (GRCm39) missense possibly damaging 0.80
IGL03196:Adgrv1 APN 13 81,594,597 (GRCm39) missense probably benign 0.02
IGL03207:Adgrv1 APN 13 81,255,017 (GRCm39) splice site probably null
IGL03343:Adgrv1 APN 13 81,431,507 (GRCm39) missense probably damaging 1.00
IGL03348:Adgrv1 APN 13 81,647,177 (GRCm39) missense possibly damaging 0.54
IGL03349:Adgrv1 APN 13 81,629,455 (GRCm39) missense probably benign 0.09
IGL03373:Adgrv1 APN 13 81,711,751 (GRCm39) missense probably damaging 0.99
IGL03381:Adgrv1 APN 13 81,666,086 (GRCm39) missense probably damaging 0.99
abetting UTSW 13 81,727,679 (GRCm39) missense probably damaging 1.00
beatle UTSW 13 81,727,713 (GRCm39) nonsense probably null
Escape UTSW 13 81,583,824 (GRCm39) missense probably benign 0.02
lento UTSW 13 81,419,016 (GRCm39) missense probably damaging 1.00
Metronome UTSW 13 81,583,678 (GRCm39) critical splice donor site probably null
Murderous UTSW 13 81,251,443 (GRCm39) missense possibly damaging 0.94
Nome UTSW 13 81,539,886 (GRCm39) missense probably benign 0.00
Propulsion UTSW 13 81,623,166 (GRCm39) missense probably benign 0.06
revulsion UTSW 13 81,743,301 (GRCm39) missense probably damaging 1.00
Saturnv UTSW 13 81,679,795 (GRCm39) missense probably damaging 1.00
Thrust UTSW 13 81,522,375 (GRCm39) missense probably benign 0.01
Velocity UTSW 13 81,545,473 (GRCm39) missense probably benign 0.00
Wilting UTSW 13 81,640,620 (GRCm39) missense probably benign 0.02
Withering UTSW 13 81,642,776 (GRCm39) missense probably damaging 1.00
F2404:Adgrv1 UTSW 13 81,568,125 (GRCm39) missense probably benign 0.13
G1patch:Adgrv1 UTSW 13 81,641,329 (GRCm39) missense probably damaging 1.00
G1patch:Adgrv1 UTSW 13 81,585,676 (GRCm39) missense probably damaging 0.99
I2288:Adgrv1 UTSW 13 81,585,643 (GRCm39) missense probably damaging 1.00
I2289:Adgrv1 UTSW 13 81,585,643 (GRCm39) missense probably damaging 1.00
PIT4377001:Adgrv1 UTSW 13 81,677,104 (GRCm39) missense probably damaging 1.00
PIT4504001:Adgrv1 UTSW 13 81,707,471 (GRCm39) missense probably damaging 0.99
R0017:Adgrv1 UTSW 13 81,727,065 (GRCm39) missense probably benign 0.13
R0017:Adgrv1 UTSW 13 81,727,065 (GRCm39) missense probably benign 0.13
R0058:Adgrv1 UTSW 13 81,330,791 (GRCm39) missense possibly damaging 0.65
R0058:Adgrv1 UTSW 13 81,330,791 (GRCm39) missense possibly damaging 0.65
R0083:Adgrv1 UTSW 13 81,726,523 (GRCm39) unclassified probably benign
R0087:Adgrv1 UTSW 13 81,535,070 (GRCm39) missense probably damaging 1.00
R0108:Adgrv1 UTSW 13 81,726,523 (GRCm39) unclassified probably benign
R0131:Adgrv1 UTSW 13 81,651,114 (GRCm39) unclassified probably benign
R0218:Adgrv1 UTSW 13 81,255,017 (GRCm39) splice site probably null
R0325:Adgrv1 UTSW 13 81,688,134 (GRCm39) missense probably damaging 1.00
R0326:Adgrv1 UTSW 13 81,623,112 (GRCm39) missense possibly damaging 0.46
R0395:Adgrv1 UTSW 13 81,534,072 (GRCm39) missense probably benign 0.00
R0441:Adgrv1 UTSW 13 81,545,345 (GRCm39) nonsense probably null
R0466:Adgrv1 UTSW 13 81,714,415 (GRCm39) missense probably benign 0.00
R0487:Adgrv1 UTSW 13 81,637,154 (GRCm39) missense probably damaging 1.00
R0501:Adgrv1 UTSW 13 81,707,269 (GRCm39) missense probably damaging 1.00
R0522:Adgrv1 UTSW 13 81,676,561 (GRCm39) splice site probably benign
R0532:Adgrv1 UTSW 13 81,727,015 (GRCm39) missense probably damaging 1.00
R0542:Adgrv1 UTSW 13 81,721,437 (GRCm39) missense probably damaging 1.00
R0681:Adgrv1 UTSW 13 81,676,649 (GRCm39) missense probably damaging 1.00
R0689:Adgrv1 UTSW 13 81,623,224 (GRCm39) missense possibly damaging 0.47
R0732:Adgrv1 UTSW 13 81,651,123 (GRCm39) missense possibly damaging 0.86
R0746:Adgrv1 UTSW 13 81,718,675 (GRCm39) missense probably benign 0.10
R0763:Adgrv1 UTSW 13 81,647,244 (GRCm39) missense probably damaging 0.98
R0846:Adgrv1 UTSW 13 81,627,861 (GRCm39) nonsense probably null
R0962:Adgrv1 UTSW 13 81,553,465 (GRCm39) missense probably benign 0.01
R1146:Adgrv1 UTSW 13 81,679,795 (GRCm39) missense probably damaging 1.00
R1146:Adgrv1 UTSW 13 81,679,795 (GRCm39) missense probably damaging 1.00
R1172:Adgrv1 UTSW 13 81,705,182 (GRCm39) missense probably damaging 0.98
R1178:Adgrv1 UTSW 13 81,588,156 (GRCm39) splice site probably benign
R1310:Adgrv1 UTSW 13 81,714,496 (GRCm39) missense probably benign 0.09
R1386:Adgrv1 UTSW 13 81,676,984 (GRCm39) missense probably benign 0.17
R1387:Adgrv1 UTSW 13 81,641,295 (GRCm39) missense possibly damaging 0.62
R1395:Adgrv1 UTSW 13 81,534,907 (GRCm39) missense probably benign 0.05
R1412:Adgrv1 UTSW 13 81,243,569 (GRCm39) missense probably damaging 1.00
R1448:Adgrv1 UTSW 13 81,581,632 (GRCm39) missense probably benign 0.08
R1470:Adgrv1 UTSW 13 81,530,417 (GRCm39) missense probably benign 0.03
R1470:Adgrv1 UTSW 13 81,530,417 (GRCm39) missense probably benign 0.03
R1485:Adgrv1 UTSW 13 81,727,738 (GRCm39) missense probably damaging 1.00
R1507:Adgrv1 UTSW 13 81,620,699 (GRCm39) critical splice acceptor site probably null
R1513:Adgrv1 UTSW 13 81,705,076 (GRCm39) missense probably damaging 1.00
R1513:Adgrv1 UTSW 13 81,741,167 (GRCm39) missense probably damaging 1.00
R1539:Adgrv1 UTSW 13 81,652,097 (GRCm39) splice site probably null
R1579:Adgrv1 UTSW 13 81,711,898 (GRCm39) missense probably damaging 1.00
R1580:Adgrv1 UTSW 13 81,614,279 (GRCm39) critical splice donor site probably null
R1611:Adgrv1 UTSW 13 81,707,236 (GRCm39) missense probably damaging 1.00
R1615:Adgrv1 UTSW 13 81,572,407 (GRCm39) missense probably benign 0.41
R1651:Adgrv1 UTSW 13 81,635,972 (GRCm39) missense probably benign 0.19
R1660:Adgrv1 UTSW 13 81,624,750 (GRCm39) missense probably benign 0.00
R1679:Adgrv1 UTSW 13 81,707,671 (GRCm39) missense probably damaging 1.00
R1709:Adgrv1 UTSW 13 81,741,179 (GRCm39) missense probably damaging 1.00
R1735:Adgrv1 UTSW 13 81,636,066 (GRCm39) missense possibly damaging 0.62
R1762:Adgrv1 UTSW 13 81,654,265 (GRCm39) missense probably benign 0.08
R1830:Adgrv1 UTSW 13 81,637,196 (GRCm39) missense possibly damaging 0.65
R1836:Adgrv1 UTSW 13 81,652,232 (GRCm39) missense probably benign 0.01
R1843:Adgrv1 UTSW 13 81,692,652 (GRCm39) missense probably damaging 1.00
R1863:Adgrv1 UTSW 13 81,711,685 (GRCm39) missense probably damaging 1.00
R1895:Adgrv1 UTSW 13 81,522,368 (GRCm39) missense probably damaging 1.00
R1907:Adgrv1 UTSW 13 81,740,670 (GRCm39) splice site probably benign
R1928:Adgrv1 UTSW 13 81,668,905 (GRCm39) missense probably benign 0.00
R1938:Adgrv1 UTSW 13 81,539,876 (GRCm39) missense probably damaging 0.99
R1944:Adgrv1 UTSW 13 81,659,030 (GRCm39) missense probably damaging 1.00
R1946:Adgrv1 UTSW 13 81,522,368 (GRCm39) missense probably damaging 1.00
R1984:Adgrv1 UTSW 13 81,671,868 (GRCm39) missense probably damaging 1.00
R2027:Adgrv1 UTSW 13 81,743,301 (GRCm39) missense probably damaging 1.00
R2063:Adgrv1 UTSW 13 81,709,588 (GRCm39) missense possibly damaging 0.81
R2116:Adgrv1 UTSW 13 81,677,132 (GRCm39) missense probably benign 0.11
R2117:Adgrv1 UTSW 13 81,640,656 (GRCm39) missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81,568,069 (GRCm39) missense probably benign 0.02
R2125:Adgrv1 UTSW 13 81,567,654 (GRCm39) missense probably benign 0.00
R2127:Adgrv1 UTSW 13 81,705,199 (GRCm39) missense probably damaging 1.00
R2128:Adgrv1 UTSW 13 81,705,199 (GRCm39) missense probably damaging 1.00
R2129:Adgrv1 UTSW 13 81,705,199 (GRCm39) missense probably damaging 1.00
R2130:Adgrv1 UTSW 13 81,729,846 (GRCm39) missense possibly damaging 0.61
R2135:Adgrv1 UTSW 13 81,672,676 (GRCm39) critical splice donor site probably null
R2138:Adgrv1 UTSW 13 81,593,439 (GRCm39) missense probably benign 0.00
R2166:Adgrv1 UTSW 13 81,716,762 (GRCm39) missense probably damaging 1.00
R2171:Adgrv1 UTSW 13 81,419,037 (GRCm39) missense probably damaging 1.00
R2191:Adgrv1 UTSW 13 81,714,409 (GRCm39) missense possibly damaging 0.90
R2256:Adgrv1 UTSW 13 81,654,259 (GRCm39) missense probably benign
R2260:Adgrv1 UTSW 13 81,716,493 (GRCm39) missense probably damaging 0.97
R2323:Adgrv1 UTSW 13 81,743,298 (GRCm39) missense probably damaging 1.00
R2432:Adgrv1 UTSW 13 81,688,251 (GRCm39) frame shift probably null
R2910:Adgrv1 UTSW 13 81,705,238 (GRCm39) missense possibly damaging 0.61
R2920:Adgrv1 UTSW 13 81,596,984 (GRCm39) missense probably benign 0.01
R2989:Adgrv1 UTSW 13 81,729,866 (GRCm39) missense probably damaging 1.00
R3402:Adgrv1 UTSW 13 81,691,661 (GRCm39) missense probably damaging 1.00
R3692:Adgrv1 UTSW 13 81,672,719 (GRCm39) missense possibly damaging 0.91
R3711:Adgrv1 UTSW 13 81,567,594 (GRCm39) missense probably benign 0.02
R3732:Adgrv1 UTSW 13 81,705,075 (GRCm39) missense probably damaging 1.00
R3732:Adgrv1 UTSW 13 81,705,075 (GRCm39) missense probably damaging 1.00
R3733:Adgrv1 UTSW 13 81,705,075 (GRCm39) missense probably damaging 1.00
R3773:Adgrv1 UTSW 13 81,647,162 (GRCm39) missense probably damaging 0.98
R3791:Adgrv1 UTSW 13 81,741,221 (GRCm39) missense probably damaging 1.00
R3794:Adgrv1 UTSW 13 81,431,486 (GRCm39) start codon destroyed probably damaging 1.00
R3848:Adgrv1 UTSW 13 81,588,191 (GRCm39) missense probably damaging 0.97
R3880:Adgrv1 UTSW 13 81,583,824 (GRCm39) missense probably benign 0.02
R3925:Adgrv1 UTSW 13 81,726,891 (GRCm39) missense possibly damaging 0.89
R3934:Adgrv1 UTSW 13 81,623,166 (GRCm39) missense probably benign 0.06
R3942:Adgrv1 UTSW 13 81,330,908 (GRCm39) missense probably damaging 1.00
R4002:Adgrv1 UTSW 13 81,688,251 (GRCm39) frame shift probably null
R4003:Adgrv1 UTSW 13 81,688,251 (GRCm39) frame shift probably null
R4194:Adgrv1 UTSW 13 81,647,115 (GRCm39) missense probably damaging 0.98
R4308:Adgrv1 UTSW 13 81,588,311 (GRCm39) missense probably damaging 0.96
R4368:Adgrv1 UTSW 13 81,641,029 (GRCm39) missense unknown
R4388:Adgrv1 UTSW 13 81,729,828 (GRCm39) missense probably damaging 0.98
R4421:Adgrv1 UTSW 13 81,714,421 (GRCm39) missense probably damaging 1.00
R4468:Adgrv1 UTSW 13 81,522,375 (GRCm39) missense probably benign 0.01
R4483:Adgrv1 UTSW 13 81,567,349 (GRCm39) missense probably benign 0.01
R4487:Adgrv1 UTSW 13 81,588,185 (GRCm39) missense probably damaging 0.99
R4566:Adgrv1 UTSW 13 81,567,927 (GRCm39) missense probably damaging 1.00
R4615:Adgrv1 UTSW 13 81,642,688 (GRCm39) splice site probably null
R4647:Adgrv1 UTSW 13 81,676,914 (GRCm39) nonsense probably null
R4657:Adgrv1 UTSW 13 81,553,483 (GRCm39) missense probably benign 0.01
R4723:Adgrv1 UTSW 13 81,581,644 (GRCm39) missense probably benign 0.02
R4765:Adgrv1 UTSW 13 81,255,038 (GRCm39) missense probably damaging 0.99
R4783:Adgrv1 UTSW 13 81,243,564 (GRCm39) missense probably damaging 0.99
R4796:Adgrv1 UTSW 13 81,303,350 (GRCm39) nonsense probably null
R4816:Adgrv1 UTSW 13 81,676,793 (GRCm39) missense probably damaging 1.00
R4833:Adgrv1 UTSW 13 81,708,963 (GRCm39) missense possibly damaging 0.81
R4841:Adgrv1 UTSW 13 81,651,120 (GRCm39) critical splice donor site probably null
R4871:Adgrv1 UTSW 13 81,681,241 (GRCm39) intron probably benign
R4897:Adgrv1 UTSW 13 81,709,704 (GRCm39) splice site probably null
R4906:Adgrv1 UTSW 13 81,418,857 (GRCm39) splice site probably null
R4917:Adgrv1 UTSW 13 81,658,996 (GRCm39) missense probably benign 0.30
R4996:Adgrv1 UTSW 13 81,726,853 (GRCm39) missense probably benign 0.01
R5030:Adgrv1 UTSW 13 81,607,948 (GRCm39) missense probably benign 0.43
R5044:Adgrv1 UTSW 13 81,637,050 (GRCm39) missense probably benign 0.01
R5052:Adgrv1 UTSW 13 81,676,940 (GRCm39) missense probably damaging 0.97
R5093:Adgrv1 UTSW 13 81,740,704 (GRCm39) missense probably damaging 1.00
R5095:Adgrv1 UTSW 13 81,243,606 (GRCm39) missense probably benign 0.00
R5119:Adgrv1 UTSW 13 81,567,546 (GRCm39) missense possibly damaging 0.93
R5133:Adgrv1 UTSW 13 81,587,560 (GRCm39) missense probably damaging 1.00
R5141:Adgrv1 UTSW 13 81,419,037 (GRCm39) missense probably damaging 1.00
R5164:Adgrv1 UTSW 13 81,583,793 (GRCm39) missense probably benign 0.00
R5180:Adgrv1 UTSW 13 81,431,535 (GRCm39) start gained probably benign
R5203:Adgrv1 UTSW 13 81,659,024 (GRCm39) missense possibly damaging 0.91
R5241:Adgrv1 UTSW 13 81,637,048 (GRCm39) nonsense probably null
R5280:Adgrv1 UTSW 13 81,545,584 (GRCm39) missense possibly damaging 0.95
R5289:Adgrv1 UTSW 13 81,669,203 (GRCm39) missense probably benign 0.04
R5304:Adgrv1 UTSW 13 81,726,372 (GRCm39) missense possibly damaging 0.93
R5310:Adgrv1 UTSW 13 81,624,809 (GRCm39) missense possibly damaging 0.95
R5338:Adgrv1 UTSW 13 81,677,165 (GRCm39) missense possibly damaging 0.80
R5352:Adgrv1 UTSW 13 81,642,776 (GRCm39) missense probably damaging 1.00
R5402:Adgrv1 UTSW 13 81,607,834 (GRCm39) missense probably benign 0.25
R5418:Adgrv1 UTSW 13 81,567,427 (GRCm39) missense probably benign 0.01
R5460:Adgrv1 UTSW 13 81,572,377 (GRCm39) missense possibly damaging 0.95
R5510:Adgrv1 UTSW 13 81,593,363 (GRCm39) missense probably damaging 1.00
R5521:Adgrv1 UTSW 13 81,567,508 (GRCm39) missense probably benign 0.01
R5538:Adgrv1 UTSW 13 81,581,808 (GRCm39) missense probably benign 0.02
R5561:Adgrv1 UTSW 13 81,624,683 (GRCm39) missense probably damaging 0.99
R5584:Adgrv1 UTSW 13 81,553,386 (GRCm39) missense probably damaging 1.00
R5608:Adgrv1 UTSW 13 81,303,395 (GRCm39) missense probably damaging 1.00
R5610:Adgrv1 UTSW 13 81,669,236 (GRCm39) missense probably damaging 1.00
R5619:Adgrv1 UTSW 13 81,620,619 (GRCm39) missense probably damaging 1.00
R5751:Adgrv1 UTSW 13 81,670,355 (GRCm39) missense probably damaging 1.00
R5832:Adgrv1 UTSW 13 81,251,421 (GRCm39) missense possibly damaging 0.95
R5885:Adgrv1 UTSW 13 81,572,390 (GRCm39) missense probably benign 0.15
R5930:Adgrv1 UTSW 13 81,545,570 (GRCm39) missense probably benign 0.06
R5937:Adgrv1 UTSW 13 81,255,194 (GRCm39) missense probably damaging 0.96
R5943:Adgrv1 UTSW 13 81,534,985 (GRCm39) missense probably damaging 0.98
R5951:Adgrv1 UTSW 13 81,590,620 (GRCm39) missense probably damaging 1.00
R5977:Adgrv1 UTSW 13 81,583,678 (GRCm39) critical splice donor site probably null
R5995:Adgrv1 UTSW 13 81,614,378 (GRCm39) missense probably benign 0.03
R6017:Adgrv1 UTSW 13 81,545,542 (GRCm39) nonsense probably null
R6024:Adgrv1 UTSW 13 81,624,624 (GRCm39) missense probably benign 0.26
R6049:Adgrv1 UTSW 13 81,545,473 (GRCm39) missense probably benign 0.00
R6108:Adgrv1 UTSW 13 81,539,814 (GRCm39) missense probably damaging 0.99
R6130:Adgrv1 UTSW 13 81,575,864 (GRCm39) missense probably damaging 0.99
R6132:Adgrv1 UTSW 13 81,654,195 (GRCm39) missense probably benign 0.04
R6149:Adgrv1 UTSW 13 81,330,893 (GRCm39) missense probably damaging 1.00
R6169:Adgrv1 UTSW 13 81,567,378 (GRCm39) missense probably benign 0.00
R6175:Adgrv1 UTSW 13 81,534,124 (GRCm39) missense probably damaging 1.00
R6184:Adgrv1 UTSW 13 81,581,957 (GRCm39) missense probably benign 0.01
R6190:Adgrv1 UTSW 13 81,672,898 (GRCm39) splice site probably null
R6190:Adgrv1 UTSW 13 81,607,882 (GRCm39) splice site probably null
R6215:Adgrv1 UTSW 13 81,727,713 (GRCm39) nonsense probably null
R6216:Adgrv1 UTSW 13 81,672,590 (GRCm39) splice site probably null
R6238:Adgrv1 UTSW 13 81,614,402 (GRCm39) missense probably benign 0.07
R6244:Adgrv1 UTSW 13 81,255,050 (GRCm39) missense probably damaging 1.00
R6298:Adgrv1 UTSW 13 81,539,886 (GRCm39) missense probably benign 0.00
R6316:Adgrv1 UTSW 13 81,647,187 (GRCm39) missense possibly damaging 0.63
R6336:Adgrv1 UTSW 13 81,534,100 (GRCm39) missense probably benign 0.09
R6358:Adgrv1 UTSW 13 81,562,702 (GRCm39) missense probably damaging 0.99
R6421:Adgrv1 UTSW 13 81,656,855 (GRCm39) missense possibly damaging 0.69
R6466:Adgrv1 UTSW 13 81,723,220 (GRCm39) splice site probably null
R6510:Adgrv1 UTSW 13 81,707,609 (GRCm39) missense possibly damaging 0.88
R6519:Adgrv1 UTSW 13 81,715,462 (GRCm39) missense probably benign 0.01
R6521:Adgrv1 UTSW 13 81,581,771 (GRCm39) missense probably damaging 1.00
R6598:Adgrv1 UTSW 13 81,654,298 (GRCm39) missense probably damaging 1.00
R6605:Adgrv1 UTSW 13 81,636,081 (GRCm39) missense possibly damaging 0.80
R6626:Adgrv1 UTSW 13 81,666,245 (GRCm39) missense probably damaging 1.00
R6633:Adgrv1 UTSW 13 81,716,762 (GRCm39) missense probably damaging 1.00
R6721:Adgrv1 UTSW 13 81,629,634 (GRCm39) missense probably benign 0.00
R6725:Adgrv1 UTSW 13 81,585,676 (GRCm39) missense probably damaging 0.99
R6725:Adgrv1 UTSW 13 81,641,329 (GRCm39) missense probably damaging 1.00
R6796:Adgrv1 UTSW 13 81,620,597 (GRCm39) missense probably damaging 1.00
R6809:Adgrv1 UTSW 13 81,621,072 (GRCm39) missense probably benign 0.01
R6823:Adgrv1 UTSW 13 81,705,200 (GRCm39) missense probably damaging 1.00
R6876:Adgrv1 UTSW 13 81,303,273 (GRCm39) critical splice donor site probably null
R6878:Adgrv1 UTSW 13 81,581,613 (GRCm39) missense probably benign 0.06
R6887:Adgrv1 UTSW 13 81,676,820 (GRCm39) missense probably benign 0.01
R6888:Adgrv1 UTSW 13 81,656,788 (GRCm39) missense probably damaging 1.00
R6957:Adgrv1 UTSW 13 81,715,609 (GRCm39) missense probably benign 0.00
R6976:Adgrv1 UTSW 13 81,669,116 (GRCm39) missense probably damaging 1.00
R7003:Adgrv1 UTSW 13 81,670,223 (GRCm39) critical splice donor site probably null
R7007:Adgrv1 UTSW 13 81,684,483 (GRCm39) missense possibly damaging 0.80
R7073:Adgrv1 UTSW 13 81,709,593 (GRCm39) missense probably damaging 1.00
R7100:Adgrv1 UTSW 13 81,419,016 (GRCm39) missense probably damaging 1.00
R7107:Adgrv1 UTSW 13 81,726,261 (GRCm39) missense probably benign 0.13
R7123:Adgrv1 UTSW 13 81,740,693 (GRCm39) missense probably damaging 1.00
R7141:Adgrv1 UTSW 13 81,640,620 (GRCm39) missense probably benign 0.02
R7168:Adgrv1 UTSW 13 81,545,328 (GRCm39) missense possibly damaging 0.52
R7205:Adgrv1 UTSW 13 81,627,777 (GRCm39) missense probably benign 0.00
R7239:Adgrv1 UTSW 13 81,624,731 (GRCm39) missense possibly damaging 0.69
R7249:Adgrv1 UTSW 13 81,522,378 (GRCm39) missense probably damaging 1.00
R7313:Adgrv1 UTSW 13 81,668,634 (GRCm39) missense possibly damaging 0.95
R7376:Adgrv1 UTSW 13 81,666,245 (GRCm39) missense probably damaging 1.00
R7392:Adgrv1 UTSW 13 81,708,808 (GRCm39) missense probably damaging 1.00
R7395:Adgrv1 UTSW 13 81,707,467 (GRCm39) missense probably damaging 1.00
R7410:Adgrv1 UTSW 13 81,711,738 (GRCm39) missense probably benign 0.04
R7449:Adgrv1 UTSW 13 81,647,192 (GRCm39) missense probably damaging 0.99
R7496:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7497:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7498:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7567:Adgrv1 UTSW 13 81,727,596 (GRCm39) missense probably damaging 1.00
R7567:Adgrv1 UTSW 13 81,581,648 (GRCm39) missense probably benign 0.00
R7614:Adgrv1 UTSW 13 81,668,780 (GRCm39) missense probably damaging 1.00
R7623:Adgrv1 UTSW 13 81,570,344 (GRCm39) missense possibly damaging 0.77
R7665:Adgrv1 UTSW 13 81,647,261 (GRCm39) missense probably damaging 1.00
R7685:Adgrv1 UTSW 13 81,251,443 (GRCm39) missense possibly damaging 0.94
R7788:Adgrv1 UTSW 13 81,721,433 (GRCm39) missense probably damaging 1.00
R7809:Adgrv1 UTSW 13 81,676,760 (GRCm39) missense possibly damaging 0.81
R7854:Adgrv1 UTSW 13 81,741,207 (GRCm39) missense probably damaging 1.00
R7894:Adgrv1 UTSW 13 81,715,570 (GRCm39) missense probably benign 0.00
R7948:Adgrv1 UTSW 13 81,707,707 (GRCm39) missense probably damaging 1.00
R7948:Adgrv1 UTSW 13 81,707,648 (GRCm39) missense probably damaging 1.00
R7949:Adgrv1 UTSW 13 81,303,353 (GRCm39) missense probably damaging 1.00
R7951:Adgrv1 UTSW 13 81,711,689 (GRCm39) missense probably damaging 1.00
R7968:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7969:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R7973:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8007:Adgrv1 UTSW 13 81,431,585 (GRCm39) missense probably benign 0.04
R8018:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8044:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8050:Adgrv1 UTSW 13 81,561,296 (GRCm39) missense probably damaging 1.00
R8090:Adgrv1 UTSW 13 81,596,953 (GRCm39) critical splice donor site probably null
R8104:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8122:Adgrv1 UTSW 13 81,419,037 (GRCm39) missense probably damaging 1.00
R8122:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8123:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8125:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8126:Adgrv1 UTSW 13 81,588,344 (GRCm39) missense possibly damaging 0.79
R8212:Adgrv1 UTSW 13 81,670,240 (GRCm39) missense probably benign 0.01
R8221:Adgrv1 UTSW 13 81,677,033 (GRCm39) missense probably benign 0.00
R8256:Adgrv1 UTSW 13 81,727,679 (GRCm39) missense probably damaging 1.00
R8270:Adgrv1 UTSW 13 81,651,163 (GRCm39) missense probably damaging 0.96
R8290:Adgrv1 UTSW 13 81,630,002 (GRCm39) missense probably benign 0.00
R8298:Adgrv1 UTSW 13 81,534,033 (GRCm39) nonsense probably null
R8317:Adgrv1 UTSW 13 81,723,236 (GRCm39) missense probably damaging 0.98
R8326:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8327:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8330:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8332:Adgrv1 UTSW 13 81,593,462 (GRCm39) missense probably damaging 1.00
R8345:Adgrv1 UTSW 13 81,251,505 (GRCm39) missense probably damaging 1.00
R8398:Adgrv1 UTSW 13 81,330,797 (GRCm39) missense probably damaging 1.00
R8399:Adgrv1 UTSW 13 81,637,289 (GRCm39) missense possibly damaging 0.55
R8450:Adgrv1 UTSW 13 81,583,962 (GRCm39) splice site probably null
R8471:Adgrv1 UTSW 13 81,594,591 (GRCm39) missense probably benign 0.00
R8534:Adgrv1 UTSW 13 81,534,887 (GRCm39) missense probably benign 0.02
R8537:Adgrv1 UTSW 13 81,684,491 (GRCm39) missense probably damaging 1.00
R8703:Adgrv1 UTSW 13 81,676,792 (GRCm39) missense probably damaging 1.00
R8845:Adgrv1 UTSW 13 81,629,478 (GRCm39) missense possibly damaging 0.79
R8846:Adgrv1 UTSW 13 81,637,025 (GRCm39) critical splice donor site probably null
R8849:Adgrv1 UTSW 13 81,669,324 (GRCm39) missense probably benign
R8856:Adgrv1 UTSW 13 81,707,621 (GRCm39) missense probably benign 0.11
R8915:Adgrv1 UTSW 13 81,715,558 (GRCm39) missense probably damaging 1.00
R8963:Adgrv1 UTSW 13 81,567,588 (GRCm39) missense probably benign
R8994:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R8995:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R8996:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R8997:Adgrv1 UTSW 13 81,553,457 (GRCm39) frame shift probably null
R9022:Adgrv1 UTSW 13 81,303,312 (GRCm39) missense probably damaging 1.00
R9059:Adgrv1 UTSW 13 81,562,692 (GRCm39) critical splice donor site probably null
R9076:Adgrv1 UTSW 13 81,570,247 (GRCm39) critical splice donor site probably null
R9119:Adgrv1 UTSW 13 81,658,995 (GRCm39) missense probably damaging 0.97
R9137:Adgrv1 UTSW 13 81,688,133 (GRCm39) missense probably damaging 1.00
R9146:Adgrv1 UTSW 13 81,561,291 (GRCm39) missense probably benign 0.11
R9156:Adgrv1 UTSW 13 81,669,302 (GRCm39) missense probably benign 0.00
R9163:Adgrv1 UTSW 13 81,567,541 (GRCm39) missense probably benign 0.19
R9282:Adgrv1 UTSW 13 81,251,491 (GRCm39) missense probably damaging 1.00
R9286:Adgrv1 UTSW 13 81,594,520 (GRCm39) missense probably damaging 0.98
R9328:Adgrv1 UTSW 13 81,620,523 (GRCm39) missense probably damaging 1.00
R9329:Adgrv1 UTSW 13 81,647,241 (GRCm39) missense probably damaging 1.00
R9350:Adgrv1 UTSW 13 81,654,274 (GRCm39) missense probably damaging 1.00
R9377:Adgrv1 UTSW 13 81,705,277 (GRCm39) missense probably damaging 0.99
R9394:Adgrv1 UTSW 13 81,624,767 (GRCm39) missense possibly damaging 0.95
R9419:Adgrv1 UTSW 13 81,656,887 (GRCm39) missense probably benign 0.44
R9427:Adgrv1 UTSW 13 81,732,234 (GRCm39) missense probably benign 0.00
R9429:Adgrv1 UTSW 13 81,741,165 (GRCm39) missense probably damaging 0.99
R9429:Adgrv1 UTSW 13 81,567,468 (GRCm39) missense probably damaging 1.00
R9433:Adgrv1 UTSW 13 81,714,471 (GRCm39) missense probably benign 0.02
R9434:Adgrv1 UTSW 13 81,666,292 (GRCm39) splice site probably benign
R9513:Adgrv1 UTSW 13 81,530,472 (GRCm39) missense possibly damaging 0.95
R9515:Adgrv1 UTSW 13 81,691,497 (GRCm39) missense probably damaging 0.99
R9523:Adgrv1 UTSW 13 81,567,178 (GRCm39) missense
R9525:Adgrv1 UTSW 13 81,593,453 (GRCm39) missense possibly damaging 0.77
R9576:Adgrv1 UTSW 13 81,691,608 (GRCm39) missense probably benign 0.06
R9612:Adgrv1 UTSW 13 81,641,082 (GRCm39) missense probably damaging 1.00
R9664:Adgrv1 UTSW 13 81,743,371 (GRCm39) missense probably damaging 1.00
R9664:Adgrv1 UTSW 13 81,670,288 (GRCm39) missense probably benign 0.01
R9702:Adgrv1 UTSW 13 81,684,483 (GRCm39) missense possibly damaging 0.80
R9717:Adgrv1 UTSW 13 81,668,900 (GRCm39) missense probably damaging 1.00
R9720:Adgrv1 UTSW 13 81,740,693 (GRCm39) missense probably damaging 1.00
X0054:Adgrv1 UTSW 13 81,707,389 (GRCm39) missense probably damaging 1.00
X0062:Adgrv1 UTSW 13 81,535,045 (GRCm39) missense probably damaging 0.99
X0067:Adgrv1 UTSW 13 81,691,511 (GRCm39) missense possibly damaging 0.51
Z1088:Adgrv1 UTSW 13 81,624,791 (GRCm39) missense probably damaging 1.00
Z1176:Adgrv1 UTSW 13 81,707,753 (GRCm39) missense possibly damaging 0.90
Z1177:Adgrv1 UTSW 13 81,567,375 (GRCm39) missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TGGCAAGAACGAATTCCTCAG -3'
(R):5'- GGGGAGCGGTCCTTAAAATG -3'

Sequencing Primer
(F):5'- AATTCCTCAGGGCCTTCAGGAAG -3'
(R):5'- CGGTCCTTAAAATGTGGTTTATTTG -3'
Posted On 2018-05-21