Incidental Mutation 'R6471:Vmn2r51'
ID 516694
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Name vomeronasal 2, receptor 51
Synonyms
MMRRC Submission 044604-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6471 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 9821125-9839586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 9836510 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 90 (D90E)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
AlphaFold L7N215
Predicted Effect possibly damaging
Transcript: ENSMUST00000094863
AA Change: D90E

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: D90E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.6%
Validation Efficiency 97% (29/30)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Birc2 A G 9: 7,857,421 (GRCm39) S351P probably benign Het
Car9 T C 4: 43,511,938 (GRCm39) V319A probably damaging Het
Ccdc86 A G 19: 10,926,243 (GRCm39) S119P unknown Het
Ciao2a T A 9: 66,034,139 (GRCm39) V4E possibly damaging Het
Cideb T C 14: 55,995,409 (GRCm39) R26G probably benign Het
Clip1 A G 5: 123,778,612 (GRCm39) V437A probably damaging Het
Cobll1 A G 2: 64,938,228 (GRCm39) S352P probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Exoc3l A G 8: 106,017,166 (GRCm39) V607A probably damaging Het
Fam227b A T 2: 125,962,985 (GRCm39) V177D probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Gdap1 T A 1: 17,230,249 (GRCm39) N227K possibly damaging Het
Glod4 A T 11: 76,124,744 (GRCm39) F185L probably damaging Het
Kif1b T C 4: 149,277,053 (GRCm39) M1337V probably benign Het
Lrrc37 T A 11: 103,510,448 (GRCm39) probably benign Het
Map3k19 C T 1: 127,744,991 (GRCm39) V1488M probably damaging Het
Pak5 A T 2: 135,958,110 (GRCm39) M326K probably benign Het
Peak1 A G 9: 56,165,543 (GRCm39) L795P probably damaging Het
Plcg1 A G 2: 160,595,630 (GRCm39) D526G probably benign Het
Rapgef6 A G 11: 54,582,563 (GRCm39) I1492V probably damaging Het
Rbfa G T 18: 80,243,673 (GRCm39) S31* probably null Het
Rnft1 T C 11: 86,382,508 (GRCm39) Y244H possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,121 (GRCm39) probably benign Het
Slc6a3 G A 13: 73,693,003 (GRCm39) G208R probably benign Het
Tex15 G T 8: 34,071,762 (GRCm39) Q2436H probably damaging Het
Ttbk1 A G 17: 46,778,203 (GRCm39) L613P probably benign Het
Tuba1b T C 15: 98,830,328 (GRCm39) K164R probably benign Het
Usp9y A G Y: 1,384,511 (GRCm39) L669P probably damaging Homo
Vmn1r169 A G 7: 23,276,970 (GRCm39) T121A probably benign Het
Zfp318 A G 17: 46,710,431 (GRCm39) H718R probably benign Het
Zfp93 T C 7: 23,972,754 (GRCm39) Y33H probably damaging Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 9,836,341 (GRCm39) missense probably benign
IGL01574:Vmn2r51 APN 7 9,836,381 (GRCm39) missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 9,834,154 (GRCm39) missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 9,839,409 (GRCm39) missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 9,834,243 (GRCm39) missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 9,832,046 (GRCm39) splice site probably benign
IGL02834:Vmn2r51 APN 7 9,832,063 (GRCm39) nonsense probably null
R0617:Vmn2r51 UTSW 7 9,834,396 (GRCm39) missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 9,834,012 (GRCm39) missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 9,836,373 (GRCm39) missense possibly damaging 0.87
R1559:Vmn2r51 UTSW 7 9,836,372 (GRCm39) missense possibly damaging 0.58
R1598:Vmn2r51 UTSW 7 9,839,432 (GRCm39) missense probably benign
R1754:Vmn2r51 UTSW 7 9,833,873 (GRCm39) missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 9,832,091 (GRCm39) nonsense probably null
R1836:Vmn2r51 UTSW 7 9,832,090 (GRCm39) nonsense probably null
R3151:Vmn2r51 UTSW 7 9,833,968 (GRCm39) missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 9,836,341 (GRCm39) missense probably benign
R4933:Vmn2r51 UTSW 7 9,832,247 (GRCm39) missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 9,821,932 (GRCm39) missense probably benign
R5050:Vmn2r51 UTSW 7 9,834,349 (GRCm39) missense probably damaging 0.99
R5510:Vmn2r51 UTSW 7 9,836,545 (GRCm39) missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 9,826,128 (GRCm39) missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 9,839,558 (GRCm39) missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 9,821,921 (GRCm39) missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 9,832,164 (GRCm39) missense probably benign 0.00
R6370:Vmn2r51 UTSW 7 9,832,143 (GRCm39) missense probably damaging 1.00
R6800:Vmn2r51 UTSW 7 9,832,191 (GRCm39) missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 9,834,025 (GRCm39) missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 9,834,480 (GRCm39) missense probably null 1.00
R7246:Vmn2r51 UTSW 7 9,836,428 (GRCm39) missense probably benign 0.00
R8939:Vmn2r51 UTSW 7 9,833,953 (GRCm39) missense possibly damaging 0.85
R9154:Vmn2r51 UTSW 7 9,839,480 (GRCm39) missense probably damaging 0.96
R9428:Vmn2r51 UTSW 7 9,833,712 (GRCm39) critical splice donor site probably benign
R9451:Vmn2r51 UTSW 7 9,833,816 (GRCm39) missense probably damaging 1.00
R9729:Vmn2r51 UTSW 7 9,839,479 (GRCm39) missense probably benign 0.00
R9767:Vmn2r51 UTSW 7 9,839,407 (GRCm39) missense probably benign 0.09
Z1176:Vmn2r51 UTSW 7 9,833,835 (GRCm39) missense probably benign 0.12
Z1176:Vmn2r51 UTSW 7 9,821,984 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ACCTCCCAATTGGATTCTGAAAG -3'
(R):5'- AGGTCCATCTGTCAATCCAATC -3'

Sequencing Primer
(F):5'- GCAGAAAGGAACACATAGTCTCTTC -3'
(R):5'- CCCGTCTTTAGATGTCAGATGCAG -3'
Posted On 2018-05-21