Incidental Mutation 'R6471:Slc6a3'
ID516708
Institutional Source Beutler Lab
Gene Symbol Slc6a3
Ensembl Gene ENSMUSG00000021609
Gene Namesolute carrier family 6 (neurotransmitter transporter, dopamine), member 3
SynonymsDat1, DAT
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6471 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location73536747-73578672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73544884 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 208 (G208R)
Ref Sequence ENSEMBL: ENSMUSP00000022100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022100]
Predicted Effect probably benign
Transcript: ENSMUST00000022100
AA Change: G208R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022100
Gene: ENSMUSG00000021609
AA Change: G208R

DomainStartEndE-ValueType
Pfam:SNF 60 582 8.1e-237 PFAM
Meta Mutation Damage Score 0.0900 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.6%
Validation Efficiency 97% (29/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit dwarfism, hyperactivity (especially in a novel environment), 5-fold higher extracellular dopamine levels, impaired spatial cognitive function, anterior pituitary hypoplasia, and failure to lactate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Birc3 A G 9: 7,857,420 S351P probably benign Het
Car9 T C 4: 43,511,938 V319A probably damaging Het
Ccdc86 A G 19: 10,948,879 S119P unknown Het
Cideb T C 14: 55,757,952 R26G probably benign Het
Clip1 A G 5: 123,640,549 V437A probably damaging Het
Cobll1 A G 2: 65,107,884 S352P probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Exoc3l A G 8: 105,290,534 V607A probably damaging Het
Fam227b A T 2: 126,121,065 V177D probably damaging Het
Fam96a T A 9: 66,126,857 V4E possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gdap1 T A 1: 17,160,025 N227K possibly damaging Het
Glod4 A T 11: 76,233,918 F185L probably damaging Het
Gm884 T A 11: 103,619,622 probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map3k19 C T 1: 127,817,254 V1488M probably damaging Het
Pak7 A T 2: 136,116,190 M326K probably benign Het
Peak1 A G 9: 56,258,259 L795P probably damaging Het
Plcg1 A G 2: 160,753,710 D526G probably benign Het
Rapgef6 A G 11: 54,691,737 I1492V probably damaging Het
Rbfa G T 18: 80,200,458 S31* probably null Het
Rnft1 T C 11: 86,491,682 Y244H possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Tex15 G T 8: 33,581,734 Q2436H probably damaging Het
Ttbk1 A G 17: 46,467,277 L613P probably benign Het
Tuba1b T C 15: 98,932,447 K164R probably benign Het
Usp9y A G Y: 1,384,511 L669P probably damaging Homo
Vmn1r169 A G 7: 23,577,545 T121A probably benign Het
Vmn2r51 A C 7: 10,102,583 D90E possibly damaging Het
Zfp318 A G 17: 46,399,505 H718R probably benign Het
Zfp93 T C 7: 24,273,329 Y33H probably damaging Het
Other mutations in Slc6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc6a3 APN 13 73544741 missense probably damaging 1.00
IGL01524:Slc6a3 APN 13 73538549 missense probably benign 0.01
IGL02015:Slc6a3 APN 13 73544714 missense possibly damaging 0.60
IGL03008:Slc6a3 APN 13 73558285 critical splice donor site probably null
IGL03029:Slc6a3 APN 13 73538697 missense probably damaging 1.00
IGL03064:Slc6a3 APN 13 73571466 missense probably damaging 0.99
IGL03272:Slc6a3 APN 13 73540929 missense probably damaging 0.98
IGL03294:Slc6a3 APN 13 73557181 critical splice donor site probably null
IGL03345:Slc6a3 APN 13 73571514 missense probably benign
IGL03410:Slc6a3 APN 13 73538657 missense probably benign 0.03
disney UTSW 13 73544884 missense probably benign
dopey UTSW 13 73560959 missense probably damaging 1.00
Dopey2 UTSW 13 73544817 missense probably damaging 1.00
Stiff UTSW 13 73557050 missense possibly damaging 0.85
PIT4382001:Slc6a3 UTSW 13 73571523 missense probably benign 0.35
R0024:Slc6a3 UTSW 13 73540837 splice site probably benign
R0125:Slc6a3 UTSW 13 73569979 splice site probably benign
R0180:Slc6a3 UTSW 13 73562336 missense probably damaging 1.00
R0288:Slc6a3 UTSW 13 73560928 missense probably damaging 1.00
R0322:Slc6a3 UTSW 13 73560926 missense possibly damaging 0.61
R0349:Slc6a3 UTSW 13 73567557 missense probably damaging 1.00
R0411:Slc6a3 UTSW 13 73557050 missense possibly damaging 0.85
R0594:Slc6a3 UTSW 13 73538642 missense probably damaging 0.99
R0680:Slc6a3 UTSW 13 73538727 missense probably damaging 1.00
R1099:Slc6a3 UTSW 13 73567641 missense probably benign 0.21
R1109:Slc6a3 UTSW 13 73557080 missense probably benign 0.00
R1791:Slc6a3 UTSW 13 73566292 missense possibly damaging 0.82
R3916:Slc6a3 UTSW 13 73562308 missense probably benign 0.00
R4279:Slc6a3 UTSW 13 73544834 missense possibly damaging 0.90
R4368:Slc6a3 UTSW 13 73560912 nonsense probably null
R4520:Slc6a3 UTSW 13 73540856 missense possibly damaging 0.95
R4666:Slc6a3 UTSW 13 73538581 missense possibly damaging 0.47
R4675:Slc6a3 UTSW 13 73544817 missense probably damaging 1.00
R4716:Slc6a3 UTSW 13 73557076 missense probably benign 0.04
R5243:Slc6a3 UTSW 13 73571451 missense possibly damaging 0.61
R5355:Slc6a3 UTSW 13 73560959 missense probably damaging 1.00
R5681:Slc6a3 UTSW 13 73538735 missense probably damaging 0.99
R5737:Slc6a3 UTSW 13 73544804 missense probably damaging 0.99
R6142:Slc6a3 UTSW 13 73544783 missense probably benign 0.00
R7168:Slc6a3 UTSW 13 73571472 missense probably benign 0.00
R7403:Slc6a3 UTSW 13 73562427 critical splice donor site probably null
R8282:Slc6a3 UTSW 13 73557081 missense probably benign 0.01
R8359:Slc6a3 UTSW 13 73544883 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGTGGGCTTCACTGTCATC -3'
(R):5'- TACTGCATAAAGAACAGGACTCGG -3'

Sequencing Primer
(F):5'- GGGCTTCACTGTCATCCTCATC -3'
(R):5'- GAACAGGACTCGGCAGCTAC -3'
Posted On2018-05-21