Incidental Mutation 'R6471:Ttbk1'
ID516713
Institutional Source Beutler Lab
Gene Symbol Ttbk1
Ensembl Gene ENSMUSG00000015599
Gene Nametau tubulin kinase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R6471 (G1)
Quality Score166.009
Status Validated
Chromosome17
Chromosomal Location46442448-46487675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46467277 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 613 (L613P)
Ref Sequence ENSEMBL: ENSMUSP00000153386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047034] [ENSMUST00000225808]
Predicted Effect probably benign
Transcript: ENSMUST00000047034
AA Change: L613P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044580
Gene: ENSMUSG00000015599
AA Change: L613P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 34 293 3.4e-21 PFAM
Pfam:Pkinase 34 305 1.7e-33 PFAM
low complexity region 320 334 N/A INTRINSIC
low complexity region 371 395 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
low complexity region 611 624 N/A INTRINSIC
low complexity region 633 653 N/A INTRINSIC
low complexity region 697 709 N/A INTRINSIC
coiled coil region 729 776 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 893 913 N/A INTRINSIC
low complexity region 945 962 N/A INTRINSIC
low complexity region 1090 1115 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Predicted Effect probably benign
Transcript: ENSMUST00000225808
AA Change: L613P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.6%
Validation Efficiency 97% (29/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary:This gene belongs to the casein kinase 1 superfamily. The encoded protein is a neuron-specific, serine/threonine and tyrosine kinase, which regulates phosphorylation of tau, a protein that associates with microtubule assemblies and stabilizes them. Genetic variants in this gene are associated with Alzheimer's disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Birc3 A G 9: 7,857,420 S351P probably benign Het
Car9 T C 4: 43,511,938 V319A probably damaging Het
Ccdc86 A G 19: 10,948,879 S119P unknown Het
Cideb T C 14: 55,757,952 R26G probably benign Het
Clip1 A G 5: 123,640,549 V437A probably damaging Het
Cobll1 A G 2: 65,107,884 S352P probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Exoc3l A G 8: 105,290,534 V607A probably damaging Het
Fam227b A T 2: 126,121,065 V177D probably damaging Het
Fam96a T A 9: 66,126,857 V4E possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gdap1 T A 1: 17,160,025 N227K possibly damaging Het
Glod4 A T 11: 76,233,918 F185L probably damaging Het
Gm884 T A 11: 103,619,622 probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map3k19 C T 1: 127,817,254 V1488M probably damaging Het
Pak7 A T 2: 136,116,190 M326K probably benign Het
Peak1 A G 9: 56,258,259 L795P probably damaging Het
Plcg1 A G 2: 160,753,710 D526G probably benign Het
Rapgef6 A G 11: 54,691,737 I1492V probably damaging Het
Rbfa G T 18: 80,200,458 S31* probably null Het
Rnft1 T C 11: 86,491,682 Y244H possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Slc6a3 G A 13: 73,544,884 G208R probably benign Het
Tex15 G T 8: 33,581,734 Q2436H probably damaging Het
Tuba1b T C 15: 98,932,447 K164R probably benign Het
Usp9y A G Y: 1,384,511 L669P probably damaging Homo
Vmn1r169 A G 7: 23,577,545 T121A probably benign Het
Vmn2r51 A C 7: 10,102,583 D90E possibly damaging Het
Zfp318 A G 17: 46,399,505 H718R probably benign Het
Zfp93 T C 7: 24,273,329 Y33H probably damaging Het
Other mutations in Ttbk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Ttbk1 APN 17 46447063 missense probably damaging 1.00
IGL02469:Ttbk1 APN 17 46470630 missense possibly damaging 0.77
IGL02826:Ttbk1 APN 17 46470660 missense probably benign
IGL02874:Ttbk1 APN 17 46470225 missense probably benign 0.10
IGL02948:Ttbk1 APN 17 46446330 missense probably benign 0.44
IGL03037:Ttbk1 APN 17 46446330 missense probably benign 0.44
R0165:Ttbk1 UTSW 17 46478938 missense possibly damaging 0.70
R1186:Ttbk1 UTSW 17 46467131 missense probably damaging 1.00
R1228:Ttbk1 UTSW 17 46476712 critical splice donor site probably null
R1423:Ttbk1 UTSW 17 46446154 splice site probably benign
R1477:Ttbk1 UTSW 17 46476799 missense probably benign 0.05
R1960:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R1961:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R4043:Ttbk1 UTSW 17 46446762 missense probably benign 0.21
R4190:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4192:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4193:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4660:Ttbk1 UTSW 17 46477788 nonsense probably null
R5383:Ttbk1 UTSW 17 46467416 missense probably damaging 1.00
R5385:Ttbk1 UTSW 17 46447632 missense probably benign 0.00
R5715:Ttbk1 UTSW 17 46479207 missense probably damaging 0.99
R6218:Ttbk1 UTSW 17 46470807 missense possibly damaging 0.47
R6263:Ttbk1 UTSW 17 46467262 missense probably damaging 1.00
R6537:Ttbk1 UTSW 17 46470310 missense probably damaging 0.98
R6552:Ttbk1 UTSW 17 46478962 missense probably benign 0.14
R7564:Ttbk1 UTSW 17 46476931 missense possibly damaging 0.66
R7853:Ttbk1 UTSW 17 46447343 missense probably benign 0.00
R7871:Ttbk1 UTSW 17 46446238 missense probably benign
R7873:Ttbk1 UTSW 17 46446568 missense probably damaging 1.00
R7908:Ttbk1 UTSW 17 46478938 missense probably damaging 1.00
R8210:Ttbk1 UTSW 17 46480161 missense possibly damaging 0.95
R8236:Ttbk1 UTSW 17 46470729 missense probably damaging 1.00
R8754:Ttbk1 UTSW 17 46445201 nonsense probably null
R8829:Ttbk1 UTSW 17 46446895 missense probably damaging 1.00
R8870:Ttbk1 UTSW 17 46470735 missense probably damaging 1.00
X0066:Ttbk1 UTSW 17 46446856 missense possibly damaging 0.74
Z1088:Ttbk1 UTSW 17 46446325 missense probably benign 0.35
Z1176:Ttbk1 UTSW 17 46460911 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGAACTCTAGGGATCTCTGGG -3'
(R):5'- TTGACAAGGAGACGGAGCTC -3'

Sequencing Primer
(F):5'- TAGGGAGGTAATGTACAAGTCCAGTC -3'
(R):5'- AGACGGAGCTCAAGGACTTCC -3'
Posted On2018-05-21