Incidental Mutation 'R6471:Rbfa'
ID516714
Institutional Source Beutler Lab
Gene Symbol Rbfa
Ensembl Gene ENSMUSG00000024570
Gene Nameribosome binding factor A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R6471 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location80192265-80200658 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 80200458 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 31 (S31*)
Ref Sequence ENSEMBL: ENSMUSP00000025462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025462]
Predicted Effect probably null
Transcript: ENSMUST00000025462
AA Change: S31*
SMART Domains Protein: ENSMUSP00000025462
Gene: ENSMUSG00000024570
AA Change: S31*

DomainStartEndE-ValueType
Pfam:RBFA 94 199 3.6e-15 PFAM
low complexity region 304 332 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.6%
Validation Efficiency 97% (29/30)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Birc3 A G 9: 7,857,420 S351P probably benign Het
Car9 T C 4: 43,511,938 V319A probably damaging Het
Ccdc86 A G 19: 10,948,879 S119P unknown Het
Cideb T C 14: 55,757,952 R26G probably benign Het
Clip1 A G 5: 123,640,549 V437A probably damaging Het
Cobll1 A G 2: 65,107,884 S352P probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Exoc3l A G 8: 105,290,534 V607A probably damaging Het
Fam227b A T 2: 126,121,065 V177D probably damaging Het
Fam96a T A 9: 66,126,857 V4E possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gdap1 T A 1: 17,160,025 N227K possibly damaging Het
Glod4 A T 11: 76,233,918 F185L probably damaging Het
Gm884 T A 11: 103,619,622 probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Map3k19 C T 1: 127,817,254 V1488M probably damaging Het
Pak7 A T 2: 136,116,190 M326K probably benign Het
Peak1 A G 9: 56,258,259 L795P probably damaging Het
Plcg1 A G 2: 160,753,710 D526G probably benign Het
Rapgef6 A G 11: 54,691,737 I1492V probably damaging Het
Rnft1 T C 11: 86,491,682 Y244H possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Slc6a3 G A 13: 73,544,884 G208R probably benign Het
Tex15 G T 8: 33,581,734 Q2436H probably damaging Het
Ttbk1 A G 17: 46,467,277 L613P probably benign Het
Tuba1b T C 15: 98,932,447 K164R probably benign Het
Usp9y A G Y: 1,384,511 L669P probably damaging Homo
Vmn1r169 A G 7: 23,577,545 T121A probably benign Het
Vmn2r51 A C 7: 10,102,583 D90E possibly damaging Het
Zfp318 A G 17: 46,399,505 H718R probably benign Het
Zfp93 T C 7: 24,273,329 Y33H probably damaging Het
Other mutations in Rbfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Rbfa APN 18 80192865 missense probably benign 0.00
IGL01555:Rbfa APN 18 80197800 missense possibly damaging 0.47
IGL02838:Rbfa APN 18 80192835 missense probably benign 0.00
IGL03214:Rbfa APN 18 80197291 missense probably benign 0.02
R4584:Rbfa UTSW 18 80200506 missense probably benign 0.05
R5293:Rbfa UTSW 18 80192766 missense probably benign 0.01
R6384:Rbfa UTSW 18 80192781 missense probably damaging 1.00
R7328:Rbfa UTSW 18 80193239 missense probably benign 0.00
Z1177:Rbfa UTSW 18 80192523 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACAACCTGTCCCCATGGTC -3'
(R):5'- ACAGCAGTCATAACTCCGCG -3'

Sequencing Primer
(F):5'- ATGGTCTCGCCCCAACC -3'
(R):5'- ATAACTCCGCGCCGCAG -3'
Posted On2018-05-21