Incidental Mutation 'R6474:Pex2'
ID516721
Institutional Source Beutler Lab
Gene Symbol Pex2
Ensembl Gene ENSMUSG00000040374
Gene Nameperoxisomal biogenesis factor 2
SynonymsD3Ertd138e, peroxisome biogenesis factor 2, Pex2, PMP35, Pxmp3, Zellweger syndrome homolog
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location5560188-5576239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5561131 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 206 (F206S)
Ref Sequence ENSEMBL: ENSMUSP00000141927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059021] [ENSMUST00000071280] [ENSMUST00000164828] [ENSMUST00000165309] [ENSMUST00000191916] [ENSMUST00000195855]
Predicted Effect probably damaging
Transcript: ENSMUST00000059021
AA Change: F206S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059415
Gene: ENSMUSG00000040374
AA Change: F206S

DomainStartEndE-ValueType
Pfam:Pex2_Pex12 26 226 1.9e-40 PFAM
RING 244 283 7.45e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000071280
AA Change: F206S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071255
Gene: ENSMUSG00000040374
AA Change: F206S

DomainStartEndE-ValueType
Pfam:Pex2_Pex12 26 226 1.9e-40 PFAM
RING 244 283 7.45e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164828
AA Change: F206S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129311
Gene: ENSMUSG00000040374
AA Change: F206S

DomainStartEndE-ValueType
Pfam:Pex2_Pex12 26 226 1.9e-40 PFAM
RING 244 283 7.45e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165309
AA Change: F206S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126445
Gene: ENSMUSG00000040374
AA Change: F206S

DomainStartEndE-ValueType
Pfam:Pex2_Pex12 26 225 3.7e-39 PFAM
RING 244 283 7.45e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191916
AA Change: F206S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141945
Gene: ENSMUSG00000040374
AA Change: F206S

DomainStartEndE-ValueType
Pfam:Pex2_Pex12 26 226 1.9e-40 PFAM
RING 244 283 7.45e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195855
AA Change: F206S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141927
Gene: ENSMUSG00000040374
AA Change: F206S

DomainStartEndE-ValueType
Pfam:Pex2_Pex12 26 226 1.9e-40 PFAM
RING 244 283 7.45e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral peroxisomal membrane protein required for peroxisome biogenesis. The protein is thought to be involved in peroxisomal matrix protein import. Mutations in this gene result in one form of Zellweger syndrome and infantile Refsum disease. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die sometime before weaning. Various abnormalities are seen in the central nervous system depending on the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Pex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Pex2 APN 3 5561364 missense probably benign 0.00
IGL03186:Pex2 APN 3 5561717 missense probably benign 0.04
R0194:Pex2 UTSW 3 5561364 missense probably benign 0.00
R0479:Pex2 UTSW 3 5561295 missense probably damaging 1.00
R2145:Pex2 UTSW 3 5561590 missense probably damaging 1.00
R2862:Pex2 UTSW 3 5561180 missense probably damaging 1.00
R3890:Pex2 UTSW 3 5560948 missense probably damaging 1.00
R3891:Pex2 UTSW 3 5560948 missense probably damaging 1.00
R4627:Pex2 UTSW 3 5561281 missense probably damaging 0.98
R5208:Pex2 UTSW 3 5561368 missense probably benign
R5884:Pex2 UTSW 3 5561299 missense probably benign
R7158:Pex2 UTSW 3 5561336 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACACTTCGGGCACGTAAAG -3'
(R):5'- GCCAAACAGTTCATGAATTTTCTGG -3'

Sequencing Primer
(F):5'- CACTTCGGGCACGTAAAGTATATGTC -3'
(R):5'- ACAGTTCATGAATTTTCTGGTTGGAC -3'
Posted On2018-05-21