Incidental Mutation 'R6474:Ppm1l'
ID516722
Institutional Source Beutler Lab
Gene Symbol Ppm1l
Ensembl Gene ENSMUSG00000027784
Gene Nameprotein phosphatase 1 (formerly 2C)-like
Synonyms5930404J21Rik, Pp2ce, PP2C-epsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location69316861-69560802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69553041 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 317 (I317N)
Ref Sequence ENSEMBL: ENSMUSP00000029355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029355]
Predicted Effect probably damaging
Transcript: ENSMUST00000029355
AA Change: I317N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029355
Gene: ENSMUSG00000027784
AA Change: I317N

DomainStartEndE-ValueType
PP2Cc 77 349 3.17e-75 SMART
PP2C_SIG 103 351 1.28e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134037
SMART Domains Protein: ENSMUSP00000120467
Gene: ENSMUSG00000027784

DomainStartEndE-ValueType
PP2Cc 3 106 6.3e-2 SMART
Meta Mutation Damage Score 0.7103 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a magnesium or manganese-requiring phosphatase that is involved in several signaling pathways. The encoded protein downregulates apoptosis signal-regulating kinase 1, a protein that initiates a signaling cascade that leads to apoptosis when cells are subjected to cytotoxic stresses. This protein also is an endoplasmic reticulum transmembrane protein that helps regulate ceramide transport from the endoplasmic reticulum to the Golgi apparatus. Finally, this gene may be involved in adiposity since it is upregulated in adipose tissues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a null allele show increased body weight and total fat mass, higher blood pressure and plasma glucose levels, lower free fatty acid levels and improved glucose tolerance. Homozygotes for another null allele show postnatal lethality, motor deficits and altered forebrain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Ppm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Ppm1l APN 3 69317950 missense probably damaging 1.00
IGL02834:Ppm1l APN 3 69549343 missense probably damaging 1.00
R0270:Ppm1l UTSW 3 69317976 splice site probably benign
R0310:Ppm1l UTSW 3 69549461 missense probably benign 0.39
R0557:Ppm1l UTSW 3 69497901 missense probably benign 0.39
R1577:Ppm1l UTSW 3 69553070 missense probably damaging 1.00
R3508:Ppm1l UTSW 3 69549480 missense possibly damaging 0.81
R4750:Ppm1l UTSW 3 69549328 missense probably damaging 0.99
R4864:Ppm1l UTSW 3 69542511 intron probably benign
R5007:Ppm1l UTSW 3 69317598 missense probably damaging 1.00
R5406:Ppm1l UTSW 3 69317594 missense possibly damaging 0.66
R6168:Ppm1l UTSW 3 69549407 missense probably damaging 1.00
R6256:Ppm1l UTSW 3 69497897 missense probably benign
R6517:Ppm1l UTSW 3 69317583 missense probably damaging 0.98
R6949:Ppm1l UTSW 3 69549403 missense possibly damaging 0.90
R7029:Ppm1l UTSW 3 69553066 missense probably benign 0.16
R7086:Ppm1l UTSW 3 69317853 missense probably damaging 1.00
R7312:Ppm1l UTSW 3 69317711 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGAATCCTAGCCATGTCTCGATC -3'
(R):5'- CTGTGTTGGGACGCATGATC -3'

Sequencing Primer
(F):5'- TCGATCCCTGGGAGACTATC -3'
(R):5'- TGGGACGCATGATCCTAATTATACCC -3'
Posted On2018-05-21