Incidental Mutation 'R6474:Clrn2'
ID516726
Institutional Source Beutler Lab
Gene Symbol Clrn2
Ensembl Gene ENSMUSG00000049530
Gene Nameclarin 2
SynonymsEG624224
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location45453751-45464149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45463732 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 156 (M156K)
Ref Sequence ENSEMBL: ENSMUSP00000058204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053250]
Predicted Effect probably benign
Transcript: ENSMUST00000053250
AA Change: M156K

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000058204
Gene: ENSMUSG00000049530
AA Change: M156K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 102 124 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
low complexity region 176 187 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the clarin family of genes. The clarins appear to belong to a large superfamily of small integral membrane glycoproteins with four transmembrane domains. The exact function of this gene is unknown. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Clrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Clrn2 APN 5 45463969 utr 3 prime probably benign
IGL01538:Clrn2 APN 5 45460066 missense probably damaging 1.00
IGL01585:Clrn2 APN 5 45460158 missense probably benign 0.00
IGL01783:Clrn2 APN 5 45460161 missense probably benign
IGL02479:Clrn2 APN 5 45463912 missense probably benign 0.03
IGL02709:Clrn2 APN 5 45460153 missense probably damaging 1.00
IGL03220:Clrn2 APN 5 45463728 missense probably damaging 1.00
R1443:Clrn2 UTSW 5 45460111 missense probably damaging 1.00
R1942:Clrn2 UTSW 5 45453995 missense probably benign 0.26
R2258:Clrn2 UTSW 5 45453962 missense probably benign 0.03
R4806:Clrn2 UTSW 5 45454004 missense probably damaging 1.00
R5943:Clrn2 UTSW 5 45463719 missense probably benign 0.01
R5987:Clrn2 UTSW 5 45454027 missense probably benign 0.09
R6029:Clrn2 UTSW 5 45460186 missense probably damaging 1.00
R6371:Clrn2 UTSW 5 45460198 missense possibly damaging 0.62
R6881:Clrn2 UTSW 5 45453822 nonsense probably null
R6939:Clrn2 UTSW 5 45453754 unclassified probably benign
R7156:Clrn2 UTSW 5 45453916 missense probably damaging 0.99
R7186:Clrn2 UTSW 5 45453773 unclassified probably benign
R7392:Clrn2 UTSW 5 45463909 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GTGATGCTCTATCAGTTCTTAAAACCC -3'
(R):5'- GGGAATTTGACTGATTGCCACC -3'

Sequencing Primer
(F):5'- TAATCCCAGCACTTTGGAGG -3'
(R):5'- CACAACCAAGTTTGCTGCGTG -3'
Posted On2018-05-21