Incidental Mutation 'R6474:Clptm1'
ID516727
Institutional Source Beutler Lab
Gene Symbol Clptm1
Ensembl Gene ENSMUSG00000002981
Gene Namecleft lip and palate associated transmembrane protein 1
SynonymsN14, HS9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19631571-19665033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19635837 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 383 (N383D)
Ref Sequence ENSEMBL: ENSMUSP00000051293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055242]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055242
AA Change: N383D

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051293
Gene: ENSMUSG00000002981
AA Change: N383D

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
Pfam:CLPTM1 56 497 5.8e-148 PFAM
transmembrane domain 507 529 N/A INTRINSIC
low complexity region 606 628 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208868
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Clptm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Clptm1 APN 7 19637700 missense probably benign 0.14
IGL01909:Clptm1 APN 7 19655776 missense probably benign 0.37
IGL03089:Clptm1 APN 7 19637147 missense probably damaging 1.00
H8786:Clptm1 UTSW 7 19635704 missense possibly damaging 0.54
R0128:Clptm1 UTSW 7 19635007 missense probably damaging 1.00
R0835:Clptm1 UTSW 7 19635674 missense possibly damaging 0.61
R1167:Clptm1 UTSW 7 19634211 missense probably damaging 1.00
R1370:Clptm1 UTSW 7 19633872 missense possibly damaging 0.61
R1655:Clptm1 UTSW 7 19645867 missense probably benign 0.00
R1855:Clptm1 UTSW 7 19638209 missense probably benign 0.05
R2004:Clptm1 UTSW 7 19646837 missense possibly damaging 0.46
R2189:Clptm1 UTSW 7 19637145 nonsense probably null
R2203:Clptm1 UTSW 7 19633892 missense possibly damaging 0.92
R3237:Clptm1 UTSW 7 19635346 missense probably damaging 0.99
R3963:Clptm1 UTSW 7 19638196 nonsense probably null
R5416:Clptm1 UTSW 7 19633816 unclassified probably benign
R6110:Clptm1 UTSW 7 19633806 unclassified probably benign
R6737:Clptm1 UTSW 7 19637076 critical splice donor site probably null
R6897:Clptm1 UTSW 7 19635826 missense possibly damaging 0.94
R8144:Clptm1 UTSW 7 19633902 missense possibly damaging 0.88
R8244:Clptm1 UTSW 7 19638991 missense possibly damaging 0.46
R8374:Clptm1 UTSW 7 19638156 missense probably benign 0.13
R8438:Clptm1 UTSW 7 19645851 missense probably benign 0.00
Z1177:Clptm1 UTSW 7 19637468 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCAACATAGAGCCTGACTC -3'
(R):5'- TTCTGCCATGCAAGGGTGTAC -3'

Sequencing Primer
(F):5'- TCACCCGGACGTCCATGAC -3'
(R):5'- ATGTATGGTCCCAGCTAACCTG -3'
Posted On2018-05-21