Incidental Mutation 'R6474:Hcst'
ID516728
Institutional Source Beutler Lab
Gene Symbol Hcst
Ensembl Gene ENSMUSG00000064109
Gene Namehematopoietic cell signal transducer
SynonymsDAP10, KAP10
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6474 (G1)
Quality Score153.008
Status Validated
Chromosome7
Chromosomal Location30417712-30419854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30417825 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 74 (N74S)
Ref Sequence ENSEMBL: ENSMUSP00000074573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032800] [ENSMUST00000075062] [ENSMUST00000108175] [ENSMUST00000108176] [ENSMUST00000208740]
Predicted Effect probably benign
Transcript: ENSMUST00000032800
SMART Domains Protein: ENSMUSP00000032800
Gene: ENSMUSG00000030579

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
PDB:2L35|A 37 78 3e-12 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000075062
AA Change: N74S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074573
Gene: ENSMUSG00000064109
AA Change: N74S

DomainStartEndE-ValueType
Pfam:DAP10 1 79 4.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108175
SMART Domains Protein: ENSMUSP00000103810
Gene: ENSMUSG00000036931

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
ANK 98 127 2.07e-2 SMART
ANK 131 160 1.5e1 SMART
ANK 166 215 5.58e1 SMART
ANK 220 250 4.93e0 SMART
ANK 257 290 8.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108176
SMART Domains Protein: ENSMUSP00000103811
Gene: ENSMUSG00000036931

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
ANK 98 127 2.07e-2 SMART
ANK 131 160 1.5e1 SMART
ANK 166 215 5.58e1 SMART
ANK 220 250 4.93e0 SMART
ANK 257 290 8.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207504
Predicted Effect probably benign
Transcript: ENSMUST00000207982
Predicted Effect probably benign
Transcript: ENSMUST00000208125
Predicted Effect unknown
Transcript: ENSMUST00000208740
AA Change: N66S
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane signaling adaptor that contains a YxxM motif in its cytoplasmic domain. The encoded protein may form part of the immune recognition receptor complex with the C-type lectin-like receptor NKG2D. As part of this receptor complex, this protein may activate phosphatidylinositol 3-kinase dependent signaling pathways through its intracytoplasmic YxxM motif. This receptor complex may have a role in cell survival and proliferation by activation of NK and T cell responses. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit osteopetrosis, decreased CD8+ T cells involved in tumor rejection, decreased uterine NK cells, and abnormal implantation site morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Hcst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03375:Hcst APN 7 30418611 intron probably benign
Predicted Primers PCR Primer
(F):5'- GGAAACCACTATGCTATCTTGGAG -3'
(R):5'- AAGTGTAGGTCCCCTAGCAGTC -3'

Sequencing Primer
(F):5'- CCACTATGCTATCTTGGAGGAAGTC -3'
(R):5'- TAGGTCCCCTAGCAGTCCCTAG -3'
Posted On2018-05-21