Mutagenetix > Incidental Mutations

Incidental Mutation 'R6474:Folh1'

516730

Institutional Source

Beutler Lab

Gene Symbol

Folh1

Ensembl Gene

ENSMUSG00000001773

Gene Name

folate hydrolase 1

Synonyms

prostate-specific membrane antigen, glutamate carboxypeptidase II, mopsm, GCP2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6474 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86718977-86775943 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86775756 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 2 (W2R)

Ref Sequence

ENSEMBL: ENSMUSP00000001824 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001824] [ENSMUST00000107271]

Predicted Effect

probably damaging
Transcript: ENSMUST00000001824
AA Change: W2R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000001824
Gene: ENSMUSG00000001773
AA Change: W2R

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:PA	171	264	2.5e-16	PFAM
Pfam:Peptidase_M28	359	561	1.2e-18	PFAM
Pfam:TFR_dimer	629	749	1.6e-37	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107271
AA Change: W2R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102892
Gene: ENSMUSG00000001773
AA Change: W2R

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:PA	167	265	7e-18	PFAM
Pfam:Peptidase_M28	339	475	2.1e-15	PFAM
Pfam:TFR_dimer	595	718	1.1e-43	PFAM

Meta Mutation Damage Score

0.2028

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.0%

Validation Efficiency

100% (35/35)

MGI Phenotype

PHENOTYPE: Homozygous mutation of this gene results in protection from peripheral neuropathy and ischemic brain injury. Homozygotes for a null allele show increased food intake, anxiety-like behavior, smaller sciatic nerve axons, and impaired angiogenesis. Homozygotes for a different null allele show less neuron degeneration and astrocyte damage after traumatic brain injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd8	T	A	8: 71,461,715	N90Y	probably damaging	Het
Alkal1	T	C	1: 6,389,446	V82A	probably damaging	Het
Ascc3	T	C	10: 50,748,836	S1607P	probably benign	Het
Ccny	A	T	18: 9,345,427	L149H	probably damaging	Het
Clptm1	T	C	7: 19,635,837	N383D	possibly damaging	Het
Clrn2	T	A	5: 45,463,732	M156K	probably benign	Het
Coro2b	T	A	9: 62,426,628	H328L	probably benign	Het
Echs1	A	T	7: 140,108,142	M250K	probably benign	Het
Ecsit	A	G	9: 22,074,685	V145A	possibly damaging	Het
Fas	G	A	19: 34,316,569	G108D	probably damaging	Het
Gba	C	T	3: 89,204,081	P51L	probably benign	Het
Grik2	C	T	10: 49,132,680	M770I	probably benign	Het
Hcst	T	C	7: 30,417,825	N74S	probably damaging	Het
Hdac9	T	A	12: 34,431,991		probably null	Het
Hsfy2	T	A	1: 56,636,991	D129V	probably damaging	Het
Htt	T	C	5: 34,824,895	V941A	probably benign	Het
Naip5	A	G	13: 100,214,663	V1279A	possibly damaging	Het
Neb	T	A	2: 52,280,612	M1683L	probably benign	Het
Nudt21	C	T	8: 94,019,654	V139I	probably benign	Het
Olfr513	T	C	7: 108,755,029	Y58H	probably damaging	Het
Pex2	A	G	3: 5,561,131	F206S	probably damaging	Het
Plek2	C	A	12: 78,896,291	R77L	probably benign	Het
Ppfia1	A	T	7: 144,506,205	D623E	possibly damaging	Het
Ppm1l	T	A	3: 69,553,041	I317N	probably damaging	Het
Prkacb	T	A	3: 146,755,724	T36S	probably damaging	Het
Sphkap	T	A	1: 83,278,823	I115F	probably damaging	Het
Sprtn	G	T	8: 124,899,134	E95*	probably null	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Tcap	C	A	11: 98,384,177	Q46K	probably benign	Het
Thada	T	C	17: 84,443,911	I546V	possibly damaging	Het
Tubal3	T	A	13: 3,933,107	S296T	probably benign	Het
Ube3a	A	G	7: 59,287,024	N683D	probably damaging	Het
Vmn2r82	T	G	10: 79,379,037	L285V	possibly damaging	Het
Zfp871	T	C	17: 32,775,673	D157G	possibly damaging	Het

Other mutations in Folh1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Folh1	APN	7	86734143	missense	probably damaging	1.00
IGL00531:Folh1	APN	7	86719769	missense	possibly damaging	0.82
IGL00772:Folh1	APN	7	86731784	missense	probably damaging	1.00
IGL01339:Folh1	APN	7	86726098	missense	probably damaging	1.00
IGL01373:Folh1	APN	7	86746142	missense	probably benign	0.39
IGL01645:Folh1	APN	7	86742227	missense	probably damaging	1.00
IGL01736:Folh1	APN	7	86742236	missense	possibly damaging	0.96
IGL02104:Folh1	APN	7	86744430	missense	possibly damaging	0.93
IGL02124:Folh1	APN	7	86725418	missense	probably damaging	0.99
IGL02338:Folh1	APN	7	86736515	splice site	probably benign
IGL02440:Folh1	APN	7	86734104	missense	probably benign	0.09
IGL02689:Folh1	APN	7	86763045	splice site	probably null
IGL02976:Folh1	APN	7	86762918	missense	probably benign
IGL03022:Folh1	APN	7	86746171	missense	possibly damaging	0.76
R0090:Folh1	UTSW	7	86725868	splice site	probably benign
R0285:Folh1	UTSW	7	86742165	splice site	probably benign
R0482:Folh1	UTSW	7	86746101	splice site	probably benign
R0492:Folh1	UTSW	7	86746192	missense	probably damaging	1.00
R1079:Folh1	UTSW	7	86771881	missense	probably damaging	1.00
R1148:Folh1	UTSW	7	86761730	missense	probably damaging	1.00
R1148:Folh1	UTSW	7	86761730	missense	probably damaging	1.00
R1493:Folh1	UTSW	7	86761730	missense	probably damaging	1.00
R1778:Folh1	UTSW	7	86761699	critical splice donor site	probably null
R1865:Folh1	UTSW	7	86725906	missense	possibly damaging	0.65
R1878:Folh1	UTSW	7	86771742	missense	probably benign
R1906:Folh1	UTSW	7	86742166	splice site	probably null
R1912:Folh1	UTSW	7	86762967	missense	possibly damaging	0.95
R2263:Folh1	UTSW	7	86719765	missense	probably benign
R3001:Folh1	UTSW	7	86723311	missense	probably damaging	1.00
R3002:Folh1	UTSW	7	86723311	missense	probably damaging	1.00
R3883:Folh1	UTSW	7	86775656	missense	possibly damaging	0.48
R4061:Folh1	UTSW	7	86756962	missense	possibly damaging	0.49
R4277:Folh1	UTSW	7	86762915	critical splice donor site	probably null
R4507:Folh1	UTSW	7	86757008	missense	probably benign
R4627:Folh1	UTSW	7	86773252	missense	probably benign	0.00
R4652:Folh1	UTSW	7	86744425	nonsense	probably null
R4653:Folh1	UTSW	7	86744425	nonsense	probably null
R4745:Folh1	UTSW	7	86723274	critical splice donor site	probably null
R5571:Folh1	UTSW	7	86734120	missense	probably damaging	1.00
R6000:Folh1	UTSW	7	86725934	missense	probably benign	0.01
R6307:Folh1	UTSW	7	86723309	missense	probably damaging	1.00
R7112:Folh1	UTSW	7	86775637	critical splice donor site	probably null
R7131:Folh1	UTSW	7	86726112	missense	probably damaging	1.00
R7449:Folh1	UTSW	7	86731748	missense	probably benign	0.00
R7494:Folh1	UTSW	7	86719699	missense	probably damaging	1.00
R7539:Folh1	UTSW	7	86725909	missense	probably benign	0.35
R7764:Folh1	UTSW	7	86762918	missense	probably benign
R7803:Folh1	UTSW	7	86726098	missense	probably damaging	1.00
R8105:Folh1	UTSW	7	86746146	missense	probably damaging	1.00
R8208:Folh1	UTSW	7	86725917	missense	probably damaging	0.98
R8347:Folh1	UTSW	7	86729118	nonsense	probably null
RF007:Folh1	UTSW	7	86775687	missense	probably benign
Z1088:Folh1	UTSW	7	86725954	missense	probably benign	0.00
Z1177:Folh1	UTSW	7	86744447	missense	probably damaging	1.00
Z1177:Folh1	UTSW	7	86761822	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCTCCATGCAAATCACTGC -3'
(R):5'- AGCCTAACTACAATTGGCTCAC -3'

Sequencing Primer
(F):5'- AAACCTCTCCTGCGGGAAGAG -3'
(R):5'- GGCTCACAGTACGCCAGAATTTG -3'

Posted On

2018-05-21