Incidental Mutation 'R6474:Folh1'
ID516730
Institutional Source Beutler Lab
Gene Symbol Folh1
Ensembl Gene ENSMUSG00000001773
Gene Namefolate hydrolase 1
Synonymsprostate-specific membrane antigen, glutamate carboxypeptidase II, mopsm, GCP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location86718977-86775943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86775756 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 2 (W2R)
Ref Sequence ENSEMBL: ENSMUSP00000001824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001824] [ENSMUST00000107271]
Predicted Effect probably damaging
Transcript: ENSMUST00000001824
AA Change: W2R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001824
Gene: ENSMUSG00000001773
AA Change: W2R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PA 171 264 2.5e-16 PFAM
Pfam:Peptidase_M28 359 561 1.2e-18 PFAM
Pfam:TFR_dimer 629 749 1.6e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107271
AA Change: W2R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102892
Gene: ENSMUSG00000001773
AA Change: W2R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PA 167 265 7e-18 PFAM
Pfam:Peptidase_M28 339 475 2.1e-15 PFAM
Pfam:TFR_dimer 595 718 1.1e-43 PFAM
Meta Mutation Damage Score 0.2028 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in protection from peripheral neuropathy and ischemic brain injury. Homozygotes for a null allele show increased food intake, anxiety-like behavior, smaller sciatic nerve axons, and impaired angiogenesis. Homozygotes for a different null allele show less neuron degeneration and astrocyte damage after traumatic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Folh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Folh1 APN 7 86734143 missense probably damaging 1.00
IGL00531:Folh1 APN 7 86719769 missense possibly damaging 0.82
IGL00772:Folh1 APN 7 86731784 missense probably damaging 1.00
IGL01339:Folh1 APN 7 86726098 missense probably damaging 1.00
IGL01373:Folh1 APN 7 86746142 missense probably benign 0.39
IGL01645:Folh1 APN 7 86742227 missense probably damaging 1.00
IGL01736:Folh1 APN 7 86742236 missense possibly damaging 0.96
IGL02104:Folh1 APN 7 86744430 missense possibly damaging 0.93
IGL02124:Folh1 APN 7 86725418 missense probably damaging 0.99
IGL02338:Folh1 APN 7 86736515 splice site probably benign
IGL02440:Folh1 APN 7 86734104 missense probably benign 0.09
IGL02689:Folh1 APN 7 86763045 splice site probably null
IGL02976:Folh1 APN 7 86762918 missense probably benign
IGL03022:Folh1 APN 7 86746171 missense possibly damaging 0.76
R0090:Folh1 UTSW 7 86725868 splice site probably benign
R0285:Folh1 UTSW 7 86742165 splice site probably benign
R0482:Folh1 UTSW 7 86746101 splice site probably benign
R0492:Folh1 UTSW 7 86746192 missense probably damaging 1.00
R1079:Folh1 UTSW 7 86771881 missense probably damaging 1.00
R1148:Folh1 UTSW 7 86761730 missense probably damaging 1.00
R1148:Folh1 UTSW 7 86761730 missense probably damaging 1.00
R1493:Folh1 UTSW 7 86761730 missense probably damaging 1.00
R1778:Folh1 UTSW 7 86761699 critical splice donor site probably null
R1865:Folh1 UTSW 7 86725906 missense possibly damaging 0.65
R1878:Folh1 UTSW 7 86771742 missense probably benign
R1906:Folh1 UTSW 7 86742166 splice site probably null
R1912:Folh1 UTSW 7 86762967 missense possibly damaging 0.95
R2263:Folh1 UTSW 7 86719765 missense probably benign
R3001:Folh1 UTSW 7 86723311 missense probably damaging 1.00
R3002:Folh1 UTSW 7 86723311 missense probably damaging 1.00
R3883:Folh1 UTSW 7 86775656 missense possibly damaging 0.48
R4061:Folh1 UTSW 7 86756962 missense possibly damaging 0.49
R4277:Folh1 UTSW 7 86762915 critical splice donor site probably null
R4507:Folh1 UTSW 7 86757008 missense probably benign
R4627:Folh1 UTSW 7 86773252 missense probably benign 0.00
R4652:Folh1 UTSW 7 86744425 nonsense probably null
R4653:Folh1 UTSW 7 86744425 nonsense probably null
R4745:Folh1 UTSW 7 86723274 critical splice donor site probably null
R5571:Folh1 UTSW 7 86734120 missense probably damaging 1.00
R6000:Folh1 UTSW 7 86725934 missense probably benign 0.01
R6307:Folh1 UTSW 7 86723309 missense probably damaging 1.00
R7112:Folh1 UTSW 7 86775637 critical splice donor site probably null
R7131:Folh1 UTSW 7 86726112 missense probably damaging 1.00
R7449:Folh1 UTSW 7 86731748 missense probably benign 0.00
R7494:Folh1 UTSW 7 86719699 missense probably damaging 1.00
R7539:Folh1 UTSW 7 86725909 missense probably benign 0.35
R7764:Folh1 UTSW 7 86762918 missense probably benign
R7803:Folh1 UTSW 7 86726098 missense probably damaging 1.00
R8105:Folh1 UTSW 7 86746146 missense probably damaging 1.00
R8208:Folh1 UTSW 7 86725917 missense probably damaging 0.98
R8347:Folh1 UTSW 7 86729118 nonsense probably null
RF007:Folh1 UTSW 7 86775687 missense probably benign
Z1088:Folh1 UTSW 7 86725954 missense probably benign 0.00
Z1177:Folh1 UTSW 7 86744447 missense probably damaging 1.00
Z1177:Folh1 UTSW 7 86761822 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTCCATGCAAATCACTGC -3'
(R):5'- AGCCTAACTACAATTGGCTCAC -3'

Sequencing Primer
(F):5'- AAACCTCTCCTGCGGGAAGAG -3'
(R):5'- GGCTCACAGTACGCCAGAATTTG -3'
Posted On2018-05-21