Incidental Mutation 'R6474:Abhd8'
ID516734
Institutional Source Beutler Lab
Gene Symbol Abhd8
Ensembl Gene ENSMUSG00000007950
Gene Nameabhydrolase domain containing 8
Synonyms0910001L24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6474 (G1)
Quality Score84.0076
Status Validated
Chromosome8
Chromosomal Location71456705-71463655 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71461715 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 90 (N90Y)
Ref Sequence ENSEMBL: ENSMUSP00000008094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008094] [ENSMUST00000048914]
Predicted Effect probably damaging
Transcript: ENSMUST00000008094
AA Change: N90Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000008094
Gene: ENSMUSG00000007950
AA Change: N90Y

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 139 148 N/A INTRINSIC
Pfam:Hydrolase_4 164 397 2e-17 PFAM
Pfam:Abhydrolase_1 168 289 1.2e-19 PFAM
Pfam:Abhydrolase_5 168 391 2.4e-20 PFAM
Pfam:Abhydrolase_6 170 403 1.4e-17 PFAM
low complexity region 411 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048914
SMART Domains Protein: ENSMUSP00000044497
Gene: ENSMUSG00000034880

DomainStartEndE-ValueType
Pfam:Ribosomal_L34 49 92 1.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212503
Meta Mutation Damage Score 0.2506 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upstream of, and in a head-to-head orientation with the gene for the mitochondrial ribosomal protein L34. The predicted protein contains alpha/beta hydrolase fold and secretory lipase domains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Abhd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Abhd8 APN 8 71457319 missense probably damaging 1.00
IGL01780:Abhd8 APN 8 71461477 missense probably benign 0.00
IGL02350:Abhd8 APN 8 71461477 missense probably benign 0.00
IGL02357:Abhd8 APN 8 71461477 missense probably benign 0.00
PIT4142001:Abhd8 UTSW 8 71461855 missense probably damaging 1.00
R0135:Abhd8 UTSW 8 71458074 missense probably benign 0.20
R0142:Abhd8 UTSW 8 71461862 missense probably damaging 0.96
R1006:Abhd8 UTSW 8 71458441 missense probably benign 0.19
R1411:Abhd8 UTSW 8 71461730 missense probably damaging 1.00
R1676:Abhd8 UTSW 8 71461873 missense probably damaging 1.00
R1937:Abhd8 UTSW 8 71461862 missense possibly damaging 0.93
R1985:Abhd8 UTSW 8 71463513 unclassified probably benign
R3724:Abhd8 UTSW 8 71461492 missense probably benign 0.14
R5254:Abhd8 UTSW 8 71458398 nonsense probably null
R5770:Abhd8 UTSW 8 71457328 missense probably benign 0.07
R6030:Abhd8 UTSW 8 71458150 missense possibly damaging 0.94
R6030:Abhd8 UTSW 8 71458150 missense possibly damaging 0.94
R6501:Abhd8 UTSW 8 71461521 nonsense probably null
R6769:Abhd8 UTSW 8 71461461 missense probably damaging 1.00
R6771:Abhd8 UTSW 8 71461461 missense probably damaging 1.00
R7406:Abhd8 UTSW 8 71461762 missense probably benign
R7770:Abhd8 UTSW 8 71458250 missense probably benign 0.09
R8268:Abhd8 UTSW 8 71457317 missense probably benign 0.02
Z1088:Abhd8 UTSW 8 71461801 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCCGTGAATGAAGAACAGC -3'
(R):5'- AGAGTGTCGAGTCCAGTGAC -3'

Sequencing Primer
(F):5'- ACCCTTGCAGCTGGTGATG -3'
(R):5'- AGTGACGGCTACACATTCG -3'
Posted On2018-05-21