Mutagenetix > Incidental Mutations

Incidental Mutation 'R6474:Abhd8'

516734

Institutional Source

Beutler Lab

Gene Symbol

Abhd8

Ensembl Gene

ENSMUSG00000007950

Gene Name

abhydrolase domain containing 8

Synonyms

0910001L24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6474 (G1)

Quality Score

84.0076

Status

Validated

Chromosome

Chromosomal Location

71456705-71463655 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 71461715 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 90 (N90Y)

Ref Sequence

ENSEMBL: ENSMUSP00000008094 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008094] [ENSMUST00000048914]

Predicted Effect

probably damaging
Transcript: ENSMUST00000008094
AA Change: N90Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000008094
Gene: ENSMUSG00000007950
AA Change: N90Y

Domain	Start	End	E-Value	Type
low complexity region	57	72	N/A	INTRINSIC
low complexity region	115	127	N/A	INTRINSIC
low complexity region	139	148	N/A	INTRINSIC
Pfam:Hydrolase_4	164	397	2e-17	PFAM
Pfam:Abhydrolase_1	168	289	1.2e-19	PFAM
Pfam:Abhydrolase_5	168	391	2.4e-20	PFAM
Pfam:Abhydrolase_6	170	403	1.4e-17	PFAM
low complexity region	411	435	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000048914

SMART Domains

Protein: ENSMUSP00000044497
Gene: ENSMUSG00000034880

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L34	49	92	1.6e-19	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212321

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212503

Meta Mutation Damage Score

0.2506

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.0%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upstream of, and in a head-to-head orientation with the gene for the mitochondrial ribosomal protein L34. The predicted protein contains alpha/beta hydrolase fold and secretory lipase domains. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkal1	T	C	1: 6,389,446	V82A	probably damaging	Het
Ascc3	T	C	10: 50,748,836	S1607P	probably benign	Het
Ccny	A	T	18: 9,345,427	L149H	probably damaging	Het
Clptm1	T	C	7: 19,635,837	N383D	possibly damaging	Het
Clrn2	T	A	5: 45,463,732	M156K	probably benign	Het
Coro2b	T	A	9: 62,426,628	H328L	probably benign	Het
Echs1	A	T	7: 140,108,142	M250K	probably benign	Het
Ecsit	A	G	9: 22,074,685	V145A	possibly damaging	Het
Fas	G	A	19: 34,316,569	G108D	probably damaging	Het
Folh1	A	G	7: 86,775,756	W2R	probably damaging	Het
Gba	C	T	3: 89,204,081	P51L	probably benign	Het
Grik2	C	T	10: 49,132,680	M770I	probably benign	Het
Hcst	T	C	7: 30,417,825	N74S	probably damaging	Het
Hdac9	T	A	12: 34,431,991		probably null	Het
Hsfy2	T	A	1: 56,636,991	D129V	probably damaging	Het
Htt	T	C	5: 34,824,895	V941A	probably benign	Het
Naip5	A	G	13: 100,214,663	V1279A	possibly damaging	Het
Neb	T	A	2: 52,280,612	M1683L	probably benign	Het
Nudt21	C	T	8: 94,019,654	V139I	probably benign	Het
Olfr513	T	C	7: 108,755,029	Y58H	probably damaging	Het
Pex2	A	G	3: 5,561,131	F206S	probably damaging	Het
Plek2	C	A	12: 78,896,291	R77L	probably benign	Het
Ppfia1	A	T	7: 144,506,205	D623E	possibly damaging	Het
Ppm1l	T	A	3: 69,553,041	I317N	probably damaging	Het
Prkacb	T	A	3: 146,755,724	T36S	probably damaging	Het
Sphkap	T	A	1: 83,278,823	I115F	probably damaging	Het
Sprtn	G	T	8: 124,899,134	E95*	probably null	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Tcap	C	A	11: 98,384,177	Q46K	probably benign	Het
Thada	T	C	17: 84,443,911	I546V	possibly damaging	Het
Tubal3	T	A	13: 3,933,107	S296T	probably benign	Het
Ube3a	A	G	7: 59,287,024	N683D	probably damaging	Het
Vmn2r82	T	G	10: 79,379,037	L285V	possibly damaging	Het
Zfp871	T	C	17: 32,775,673	D157G	possibly damaging	Het

Other mutations in Abhd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Abhd8	APN	8	71457319	missense	probably damaging	1.00
IGL01780:Abhd8	APN	8	71461477	missense	probably benign	0.00
IGL02350:Abhd8	APN	8	71461477	missense	probably benign	0.00
IGL02357:Abhd8	APN	8	71461477	missense	probably benign	0.00
PIT4142001:Abhd8	UTSW	8	71461855	missense	probably damaging	1.00
R0135:Abhd8	UTSW	8	71458074	missense	probably benign	0.20
R0142:Abhd8	UTSW	8	71461862	missense	probably damaging	0.96
R1006:Abhd8	UTSW	8	71458441	missense	probably benign	0.19
R1411:Abhd8	UTSW	8	71461730	missense	probably damaging	1.00
R1676:Abhd8	UTSW	8	71461873	missense	probably damaging	1.00
R1937:Abhd8	UTSW	8	71461862	missense	possibly damaging	0.93
R1985:Abhd8	UTSW	8	71463513	unclassified	probably benign
R3724:Abhd8	UTSW	8	71461492	missense	probably benign	0.14
R5254:Abhd8	UTSW	8	71458398	nonsense	probably null
R5770:Abhd8	UTSW	8	71457328	missense	probably benign	0.07
R6030:Abhd8	UTSW	8	71458150	missense	possibly damaging	0.94
R6030:Abhd8	UTSW	8	71458150	missense	possibly damaging	0.94
R6501:Abhd8	UTSW	8	71461521	nonsense	probably null
R6769:Abhd8	UTSW	8	71461461	missense	probably damaging	1.00
R6771:Abhd8	UTSW	8	71461461	missense	probably damaging	1.00
R7406:Abhd8	UTSW	8	71461762	missense	probably benign
R7770:Abhd8	UTSW	8	71458250	missense	probably benign	0.09
R8268:Abhd8	UTSW	8	71457317	missense	probably benign	0.02
Z1088:Abhd8	UTSW	8	71461801	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTCCGTGAATGAAGAACAGC -3'
(R):5'- AGAGTGTCGAGTCCAGTGAC -3'

Sequencing Primer
(F):5'- ACCCTTGCAGCTGGTGATG -3'
(R):5'- AGTGACGGCTACACATTCG -3'

Posted On

2018-05-21