Incidental Mutation 'R6474:Sprtn'
ID516736
Institutional Source Beutler Lab
Gene Symbol Sprtn
Ensembl Gene ENSMUSG00000031986
Gene NameSprT-like N-terminal domain
SynonymsGm505, LOC244666
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R6474 (G1)
Quality Score183.009
Status Validated
Chromosome8
Chromosomal Location124897886-124906161 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 124899134 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 95 (E95*)
Ref Sequence ENSEMBL: ENSMUSP00000034467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034467] [ENSMUST00000098312]
Predicted Effect probably null
Transcript: ENSMUST00000034467
AA Change: E95*
SMART Domains Protein: ENSMUSP00000034467
Gene: ENSMUSG00000031986
AA Change: E95*

DomainStartEndE-ValueType
SprT 44 213 4.39e-72 SMART
low complexity region 383 405 N/A INTRINSIC
low complexity region 442 462 N/A INTRINSIC
Blast:ZnF_Rad18 463 485 8e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000098312
SMART Domains Protein: ENSMUSP00000095915
Gene: ENSMUSG00000074030

DomainStartEndE-ValueType
Pfam:Vps51 13 99 7.1e-21 PFAM
PH 174 275 2.07e-6 SMART
low complexity region 279 294 N/A INTRINSIC
low complexity region 304 319 N/A INTRINSIC
Pfam:Exo84_C 326 531 6.8e-59 PFAM
low complexity region 633 646 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213052
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may play a role in DNA repair during replication of damaged DNA. This protein recruits valosin containing protein (p97) to stalled DNA replication forks where it may prevent excessive translesional DNA synthesis and limit the number of DNA-damage induced mutations. It may also be involved in replication-related G2/M-checkpoint regulation. Deficiency of a similar protein in mouse causes chromosomal instability and progeroid phenotypes. Mutations in this gene have been associated with Ruijs-Aalfs syndrome (RJALS). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die prior to implantation. Mice homozygous for a hypomorphic allele exhibit symptoms of progeria (lordokyphosis, cataracts, cachexia, reduced total fat mass and decreased exercise performance). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Sprtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Sprtn APN 8 124900298 missense probably damaging 1.00
IGL02735:Sprtn APN 8 124903387 missense probably benign 0.03
IGL02740:Sprtn APN 8 124898303 missense probably damaging 1.00
IGL03234:Sprtn APN 8 124903149 missense possibly damaging 0.79
R0600:Sprtn UTSW 8 124900218 missense probably damaging 1.00
R1718:Sprtn UTSW 8 124898357 missense probably damaging 1.00
R1719:Sprtn UTSW 8 124901633 missense probably damaging 1.00
R1808:Sprtn UTSW 8 124903031 missense probably benign 0.03
R6390:Sprtn UTSW 8 124903219 missense probably benign 0.01
R7163:Sprtn UTSW 8 124898305 missense probably damaging 1.00
R7239:Sprtn UTSW 8 124900244 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTAGGGATTTGCTGCCCAC -3'
(R):5'- CCTAAGGAACAGAGACTCTTGTC -3'

Sequencing Primer
(F):5'- ACATACTCTGTAGACCAGGCTGG -3'
(R):5'- CCAGTCTACAGAGTGAGTTCCAG -3'
Posted On2018-05-21