Incidental Mutation 'R6474:Ecsit'
ID516737
Institutional Source Beutler Lab
Gene Symbol Ecsit
Ensembl Gene ENSMUSG00000066839
Gene NameECSIT signalling integrator
SynonymsSitpec
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location22072246-22085438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22074685 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 145 (V145A)
Ref Sequence ENSEMBL: ENSMUSP00000135936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043922] [ENSMUST00000098937] [ENSMUST00000177967] [ENSMUST00000179422] [ENSMUST00000179605] [ENSMUST00000180180]
Predicted Effect probably benign
Transcript: ENSMUST00000043922
SMART Domains Protein: ENSMUSP00000045895
Gene: ENSMUSG00000038895

DomainStartEndE-ValueType
AT_hook 29 41 2.28e0 SMART
low complexity region 105 116 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 209 232 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
ZnF_C2H2 467 492 4.11e-2 SMART
ZnF_C2H2 498 522 4.47e-3 SMART
ZnF_C2H2 528 550 4.87e-4 SMART
ZnF_C2H2 556 578 2.99e-4 SMART
ZnF_C2H2 586 609 1.31e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098937
AA Change: V215A

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096537
Gene: ENSMUSG00000066839
AA Change: V215A

DomainStartEndE-ValueType
Pfam:ECSIT 39 267 5e-106 PFAM
ECIST_Cterm 269 394 2.19e-72 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177967
AA Change: V145A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135936
Gene: ENSMUSG00000066839
AA Change: V145A

DomainStartEndE-ValueType
Pfam:ECSIT 1 197 4.4e-101 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179422
AA Change: V215A

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137424
Gene: ENSMUSG00000066839
AA Change: V215A

DomainStartEndE-ValueType
Pfam:ECSIT 39 267 5e-106 PFAM
ECIST_Cterm 269 394 2.19e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179605
SMART Domains Protein: ENSMUSP00000137064
Gene: ENSMUSG00000038895

DomainStartEndE-ValueType
AT_hook 29 41 2.28e0 SMART
low complexity region 105 116 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 209 232 N/A INTRINSIC
low complexity region 451 464 N/A INTRINSIC
ZnF_C2H2 475 500 4.11e-2 SMART
ZnF_C2H2 506 530 4.47e-3 SMART
ZnF_C2H2 536 558 4.87e-4 SMART
ZnF_C2H2 564 586 2.99e-4 SMART
ZnF_C2H2 594 617 1.31e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000180180
AA Change: V215A

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136247
Gene: ENSMUSG00000066839
AA Change: V215A

DomainStartEndE-ValueType
Pfam:ECSIT 44 266 6.2e-108 PFAM
ECIST_Cterm 269 394 2.19e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180419
Predicted Effect probably benign
Transcript: ENSMUST00000213738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216916
Meta Mutation Damage Score 0.4322 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die around the stage of gastrulation showing abnormal epiblast patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Ecsit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Ecsit APN 9 22073014 missense probably benign 0.00
IGL02114:Ecsit APN 9 22078144 splice site probably benign
IGL02457:Ecsit APN 9 22078204 missense probably damaging 0.98
IGL03365:Ecsit APN 9 22076526 missense probably damaging 0.99
charade UTSW 9 22073484 missense probably damaging 1.00
hoax UTSW 9 22076500 missense probably benign 0.00
PIT4458001:Ecsit UTSW 9 22076284 missense probably damaging 1.00
R0051:Ecsit UTSW 9 22076288 missense probably benign 0.01
R0051:Ecsit UTSW 9 22076288 missense probably benign 0.01
R0684:Ecsit UTSW 9 22076500 missense probably benign 0.00
R1703:Ecsit UTSW 9 22074811 missense probably damaging 1.00
R1903:Ecsit UTSW 9 22076519 missense possibly damaging 0.74
R1916:Ecsit UTSW 9 22072521 missense probably benign
R2280:Ecsit UTSW 9 22076540 missense possibly damaging 0.73
R2281:Ecsit UTSW 9 22076540 missense possibly damaging 0.73
R5983:Ecsit UTSW 9 22078147 critical splice donor site probably null
R6157:Ecsit UTSW 9 22074691 missense probably damaging 1.00
R7977:Ecsit UTSW 9 22073484 missense probably damaging 1.00
R7987:Ecsit UTSW 9 22073484 missense probably damaging 1.00
R8050:Ecsit UTSW 9 22076296 missense probably benign 0.03
X0024:Ecsit UTSW 9 22074815 critical splice acceptor site probably null
X0025:Ecsit UTSW 9 22072404 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATAGACTAAGACAGGTCCAACTG -3'
(R):5'- TGTTCTTACTGACTTCAAACTTGTG -3'

Sequencing Primer
(F):5'- ACGATCACGGTCACTGTCAG -3'
(R):5'- GTTTAACAAGTCCTGGATCTGC -3'
Posted On2018-05-21