Mutagenetix > Incidental Mutations

Incidental Mutation 'R6474:Grik2'

516739

Institutional Source

Beutler Lab

Gene Symbol

Grik2

Ensembl Gene

ENSMUSG00000056073

Gene Name

glutamate receptor, ionotropic, kainate 2 (beta 2)

Synonyms

Glurbeta2, Glur-6, Glur6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6474 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

49094833-49788766 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 49132680 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 770 (M770I)

Ref Sequence

ENSEMBL: ENSMUSP00000151921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079751] [ENSMUST00000105484] [ENSMUST00000218441] [ENSMUST00000218598] [ENSMUST00000218823]

Predicted Effect

probably benign
Transcript: ENSMUST00000079751
AA Change: M770I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000078687
Gene: ENSMUSG00000056073
AA Change: M770I

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	1.8e-11	PFAM
Pfam:ANF_receptor	52	395	8.3e-75	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000105484
AA Change: M770I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101124
Gene: ENSMUSG00000056073
AA Change: M770I

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	46	386	5e-11	PFAM
Pfam:ANF_receptor	52	395	9.7e-80	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	1e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217673

Predicted Effect

probably benign
Transcript: ENSMUST00000218441
AA Change: M770I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000218598
AA Change: M770I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000218823
AA Change: M770I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

unknown
Transcript: ENSMUST00000219509
AA Change: M209I

Meta Mutation Damage Score

0.0598

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.0%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hippocampal neurons with reduced sensitivity to kainate and reduced susceptibility to the seizure-inducing effects of kainate administration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd8	T	A	8: 71,461,715	N90Y	probably damaging	Het
Alkal1	T	C	1: 6,389,446	V82A	probably damaging	Het
Ascc3	T	C	10: 50,748,836	S1607P	probably benign	Het
Ccny	A	T	18: 9,345,427	L149H	probably damaging	Het
Clptm1	T	C	7: 19,635,837	N383D	possibly damaging	Het
Clrn2	T	A	5: 45,463,732	M156K	probably benign	Het
Coro2b	T	A	9: 62,426,628	H328L	probably benign	Het
Echs1	A	T	7: 140,108,142	M250K	probably benign	Het
Ecsit	A	G	9: 22,074,685	V145A	possibly damaging	Het
Fas	G	A	19: 34,316,569	G108D	probably damaging	Het
Folh1	A	G	7: 86,775,756	W2R	probably damaging	Het
Gba	C	T	3: 89,204,081	P51L	probably benign	Het
Hcst	T	C	7: 30,417,825	N74S	probably damaging	Het
Hdac9	T	A	12: 34,431,991		probably null	Het
Hsfy2	T	A	1: 56,636,991	D129V	probably damaging	Het
Htt	T	C	5: 34,824,895	V941A	probably benign	Het
Naip5	A	G	13: 100,214,663	V1279A	possibly damaging	Het
Neb	T	A	2: 52,280,612	M1683L	probably benign	Het
Nudt21	C	T	8: 94,019,654	V139I	probably benign	Het
Olfr513	T	C	7: 108,755,029	Y58H	probably damaging	Het
Pex2	A	G	3: 5,561,131	F206S	probably damaging	Het
Plek2	C	A	12: 78,896,291	R77L	probably benign	Het
Ppfia1	A	T	7: 144,506,205	D623E	possibly damaging	Het
Ppm1l	T	A	3: 69,553,041	I317N	probably damaging	Het
Prkacb	T	A	3: 146,755,724	T36S	probably damaging	Het
Sphkap	T	A	1: 83,278,823	I115F	probably damaging	Het
Sprtn	G	T	8: 124,899,134	E95*	probably null	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Tcap	C	A	11: 98,384,177	Q46K	probably benign	Het
Thada	T	C	17: 84,443,911	I546V	possibly damaging	Het
Tubal3	T	A	13: 3,933,107	S296T	probably benign	Het
Ube3a	A	G	7: 59,287,024	N683D	probably damaging	Het
Vmn2r82	T	G	10: 79,379,037	L285V	possibly damaging	Het
Zfp871	T	C	17: 32,775,673	D157G	possibly damaging	Het

Other mutations in Grik2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00863:Grik2	APN	10	49355928	missense	possibly damaging	0.95
IGL00979:Grik2	APN	10	49355938	missense	probably damaging	1.00
IGL01012:Grik2	APN	10	49272956	missense	probably damaging	1.00
IGL01302:Grik2	APN	10	49244330	missense	probably damaging	0.99
IGL01657:Grik2	APN	10	49527986	critical splice donor site	probably null
IGL02162:Grik2	APN	10	49422575	missense	possibly damaging	0.77
IGL02317:Grik2	APN	10	49422615	missense	probably benign	0.16
IGL02512:Grik2	APN	10	49355912	missense	probably benign	0.00
IGL02650:Grik2	APN	10	49101235	missense	probably benign	0.03
IGL03283:Grik2	APN	10	49578269	missense	probably benign	0.00
BB004:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
BB014:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
R0325:Grik2	UTSW	10	49240725	missense	probably damaging	1.00
R0492:Grik2	UTSW	10	49101164	missense	probably damaging	0.99
R0601:Grik2	UTSW	10	49422597	missense	probably damaging	1.00
R0844:Grik2	UTSW	10	49101115	missense	possibly damaging	0.81
R1333:Grik2	UTSW	10	49527991	missense	probably damaging	0.98
R1499:Grik2	UTSW	10	49132775	missense	probably damaging	1.00
R1660:Grik2	UTSW	10	49244343	nonsense	probably null
R1721:Grik2	UTSW	10	49523746	missense	possibly damaging	0.93
R1966:Grik2	UTSW	10	49355909	missense	probably damaging	1.00
R1974:Grik2	UTSW	10	49132827	missense	possibly damaging	0.85
R2246:Grik2	UTSW	10	49535436	missense	probably damaging	1.00
R3103:Grik2	UTSW	10	49240772	missense	probably damaging	1.00
R3974:Grik2	UTSW	10	49422654	missense	probably damaging	1.00
R4592:Grik2	UTSW	10	49422615	missense	possibly damaging	0.48
R4658:Grik2	UTSW	10	49523792	missense	possibly damaging	0.71
R4748:Grik2	UTSW	10	49535341	missense	possibly damaging	0.87
R4935:Grik2	UTSW	10	49240730	missense	probably damaging	1.00
R4977:Grik2	UTSW	10	49132745	missense	probably damaging	1.00
R5103:Grik2	UTSW	10	49496109	missense	probably benign	0.33
R5330:Grik2	UTSW	10	49132771	missense	probably damaging	1.00
R5331:Grik2	UTSW	10	49132771	missense	probably damaging	1.00
R5736:Grik2	UTSW	10	49404410	missense	probably damaging	0.96
R5740:Grik2	UTSW	10	49113477	missense	probably damaging	0.99
R5747:Grik2	UTSW	10	49523774	missense	probably benign
R6015:Grik2	UTSW	10	49523863	splice site	probably null
R6311:Grik2	UTSW	10	49578138	missense	probably damaging	0.98
R6504:Grik2	UTSW	10	49356102	missense	probably damaging	1.00
R6591:Grik2	UTSW	10	49272925	nonsense	probably null
R6691:Grik2	UTSW	10	49272925	nonsense	probably null
R6776:Grik2	UTSW	10	49355989	missense	probably damaging	1.00
R7015:Grik2	UTSW	10	49535436	missense	probably damaging	1.00
R7094:Grik2	UTSW	10	49355916	missense	possibly damaging	0.75
R7153:Grik2	UTSW	10	49535367	missense	probably benign	0.00
R7229:Grik2	UTSW	10	49101416	splice site	probably null
R7402:Grik2	UTSW	10	49535397	missense	probably damaging	1.00
R7473:Grik2	UTSW	10	49113522	missense	probably benign	0.22
R7514:Grik2	UTSW	10	49523808	missense	probably damaging	0.99
R7526:Grik2	UTSW	10	49523822	missense	possibly damaging	0.56
R7657:Grik2	UTSW	10	49783151	missense	probably benign	0.11
R7681:Grik2	UTSW	10	49244380	missense	probably damaging	1.00
R7714:Grik2	UTSW	10	49419696	missense	probably damaging	0.97
R7927:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
R7952:Grik2	UTSW	10	49422537	missense	probably benign	0.15
R7979:Grik2	UTSW	10	49404342	missense	probably benign	0.01
R8062:Grik2	UTSW	10	49240767	missense	probably damaging	1.00
R8222:Grik2	UTSW	10	49573648	missense	probably benign	0.29
R8406:Grik2	UTSW	10	49272767	missense	probably damaging	1.00
RF008:Grik2	UTSW	10	49244384	missense	probably damaging	1.00
X0062:Grik2	UTSW	10	49272920	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGTTTGGAGCCTGAGACC -3'
(R):5'- AGGAGACAGTCTGTGCTTGTC -3'

Sequencing Primer
(F):5'- GAGACCGGTTTGCCCATTTTTAATC -3'
(R):5'- GACAGTCTGTGCTTGTCAAAAG -3'

Posted On

2018-05-21