Incidental Mutation 'R6474:Vmn2r82'
ID516741
Institutional Source Beutler Lab
Gene Symbol Vmn2r82
Ensembl Gene ENSMUSG00000091468
Gene Namevomeronasal 2, receptor 82
SynonymsEG624845
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79356576-79397198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 79379037 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 285 (L285V)
Ref Sequence ENSEMBL: ENSMUSP00000130114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170596]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170596
AA Change: L285V

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130114
Gene: ENSMUSG00000091468
AA Change: L285V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 79 474 6e-35 PFAM
Pfam:NCD3G 517 570 9.3e-22 PFAM
Pfam:7tm_3 603 838 6.5e-49 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Vmn2r82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Vmn2r82 APN 10 79356747 missense probably benign 0.03
IGL01860:Vmn2r82 APN 10 79378857 missense probably benign 0.18
IGL01927:Vmn2r82 APN 10 79378072 missense probably damaging 1.00
IGL01929:Vmn2r82 APN 10 79378711 missense probably damaging 1.00
IGL02028:Vmn2r82 APN 10 79379223 missense probably benign
IGL02112:Vmn2r82 APN 10 79395999 missense probably benign 0.19
IGL02632:Vmn2r82 APN 10 79356708 missense probably benign 0.45
IGL02665:Vmn2r82 APN 10 79379371 missense probably damaging 0.99
IGL02716:Vmn2r82 APN 10 79377844 missense probably benign 0.20
IGL03030:Vmn2r82 APN 10 79381315 missense possibly damaging 0.85
IGL03190:Vmn2r82 APN 10 79356809 splice site probably null
IGL03349:Vmn2r82 APN 10 79377869 missense probably benign 0.25
IGL03048:Vmn2r82 UTSW 10 79396626 missense probably damaging 0.98
R0080:Vmn2r82 UTSW 10 79396505 missense probably benign 0.00
R0193:Vmn2r82 UTSW 10 79381295 missense probably damaging 1.00
R0217:Vmn2r82 UTSW 10 79378800 missense possibly damaging 0.46
R0285:Vmn2r82 UTSW 10 79396557 missense probably damaging 1.00
R1193:Vmn2r82 UTSW 10 79377905 nonsense probably null
R1385:Vmn2r82 UTSW 10 79396491 nonsense probably null
R1386:Vmn2r82 UTSW 10 79378711 missense probably damaging 1.00
R1442:Vmn2r82 UTSW 10 79379367 missense probably benign 0.03
R1467:Vmn2r82 UTSW 10 79396299 missense probably benign 0.00
R1467:Vmn2r82 UTSW 10 79396299 missense probably benign 0.00
R1518:Vmn2r82 UTSW 10 79378868 missense probably damaging 1.00
R1538:Vmn2r82 UTSW 10 79356744 missense possibly damaging 0.92
R1607:Vmn2r82 UTSW 10 79379419 missense possibly damaging 0.67
R1812:Vmn2r82 UTSW 10 79379212 missense probably benign 0.33
R1906:Vmn2r82 UTSW 10 79396510 missense probably damaging 1.00
R1954:Vmn2r82 UTSW 10 79396056 missense probably damaging 1.00
R1972:Vmn2r82 UTSW 10 79378846 missense probably damaging 1.00
R2093:Vmn2r82 UTSW 10 79395979 missense probably benign 0.30
R2156:Vmn2r82 UTSW 10 79378888 missense probably damaging 1.00
R2202:Vmn2r82 UTSW 10 79356685 missense probably benign
R2442:Vmn2r82 UTSW 10 79385376 missense probably damaging 1.00
R2444:Vmn2r82 UTSW 10 79377868 missense possibly damaging 0.65
R2857:Vmn2r82 UTSW 10 79381256 missense probably damaging 0.98
R2858:Vmn2r82 UTSW 10 79381256 missense probably damaging 0.98
R2884:Vmn2r82 UTSW 10 79396248 missense probably benign 0.00
R2886:Vmn2r82 UTSW 10 79396248 missense probably benign 0.00
R4369:Vmn2r82 UTSW 10 79396080 missense probably benign 0.01
R4445:Vmn2r82 UTSW 10 79379040 missense possibly damaging 0.87
R4589:Vmn2r82 UTSW 10 79356714 missense probably damaging 1.00
R4703:Vmn2r82 UTSW 10 79378807 missense probably damaging 1.00
R4908:Vmn2r82 UTSW 10 79378755 missense probably benign 0.00
R4937:Vmn2r82 UTSW 10 79379176 missense probably benign 0.01
R5199:Vmn2r82 UTSW 10 79396087 missense probably damaging 1.00
R5391:Vmn2r82 UTSW 10 79356657 missense probably null 0.01
R5601:Vmn2r82 UTSW 10 79396191 missense probably damaging 1.00
R5635:Vmn2r82 UTSW 10 79378818 missense probably benign 0.33
R6065:Vmn2r82 UTSW 10 79385376 missense probably damaging 1.00
R6074:Vmn2r82 UTSW 10 79396543 missense probably damaging 1.00
R6340:Vmn2r82 UTSW 10 79395893 missense probably benign 0.00
R6995:Vmn2r82 UTSW 10 79396543 missense probably damaging 1.00
R7111:Vmn2r82 UTSW 10 79378771 missense probably benign 0.22
R7212:Vmn2r82 UTSW 10 79379434 missense probably benign 0.00
R7335:Vmn2r82 UTSW 10 79378888 missense probably damaging 1.00
R7353:Vmn2r82 UTSW 10 79396618 missense probably benign 0.11
R7354:Vmn2r82 UTSW 10 79356630 missense probably benign 0.00
R7362:Vmn2r82 UTSW 10 79396617 missense probably benign 0.00
R7378:Vmn2r82 UTSW 10 79396442 nonsense probably null
R7430:Vmn2r82 UTSW 10 79381253 missense probably damaging 1.00
R7509:Vmn2r82 UTSW 10 79396008 missense possibly damaging 0.82
R7874:Vmn2r82 UTSW 10 79396511 missense probably damaging 1.00
R7943:Vmn2r82 UTSW 10 79396245 missense possibly damaging 0.74
R8158:Vmn2r82 UTSW 10 79377802 missense probably benign 0.12
R8324:Vmn2r82 UTSW 10 79378893 nonsense probably null
R8340:Vmn2r82 UTSW 10 79381202 missense probably benign 0.00
Z1088:Vmn2r82 UTSW 10 79356622 missense probably damaging 1.00
Z1177:Vmn2r82 UTSW 10 79356595 missense probably benign 0.03
Z1177:Vmn2r82 UTSW 10 79396535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTCAACTGGAACTGGGTGG -3'
(R):5'- GGGTGGCTTCTTGCATAAAC -3'

Sequencing Primer
(F):5'- AACTGGGTGGGACTCCTCATC -3'
(R):5'- ACTTTTTGAAACCAGCAATCTCC -3'
Posted On2018-05-21