Incidental Mutation 'R6474:Plek2'
ID516744
Institutional Source Beutler Lab
Gene Symbol Plek2
Ensembl Gene ENSMUSG00000021118
Gene Namepleckstrin 2
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_013738; MGI: 1351466

Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location78888691-78906964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 78896291 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 77 (R77L)
Ref Sequence ENSEMBL: ENSMUSP00000021544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021544]
PDB Structure
Solution structure of the DEP domain of mouse pleckstrin2 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000021544
AA Change: R77L

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021544
Gene: ENSMUSG00000021118
AA Change: R77L

DomainStartEndE-ValueType
PH 5 106 7.18e-15 SMART
DEP 139 225 3.49e-19 SMART
PH 248 353 5e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene associates with membrane-bound phosphatidylinositols generated by phosphatidylinositol 3-kinase. The encoded protein then interacts with the actin cytoskeleton to induce cell spreading. In conjunction with complement component 1, q subcomponent, B chain (C1QB), this gene shows an increase in expression in melanoma cells and may serve as an accurate biomarker for the disease. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Plek2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Plek2 APN 12 78894953 missense possibly damaging 0.68
IGL01945:Plek2 APN 12 78892148 missense probably damaging 1.00
3-1:Plek2 UTSW 12 78894172 missense possibly damaging 0.89
R0141:Plek2 UTSW 12 78894504 missense probably damaging 1.00
R0555:Plek2 UTSW 12 78892172 missense probably damaging 1.00
R1686:Plek2 UTSW 12 78894410 missense probably damaging 1.00
R1925:Plek2 UTSW 12 78894890 missense probably damaging 1.00
R4769:Plek2 UTSW 12 78906890 critical splice donor site probably null
R5595:Plek2 UTSW 12 78894109 missense probably benign
R6102:Plek2 UTSW 12 78900093 missense possibly damaging 0.56
R6943:Plek2 UTSW 12 78889309 critical splice acceptor site probably null
R7423:Plek2 UTSW 12 78900110 missense probably damaging 1.00
R8155:Plek2 UTSW 12 78896292 nonsense probably null
X0013:Plek2 UTSW 12 78894521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAGTACTATAGGGCTCTCC -3'
(R):5'- ATGTGTGCTGTCTCACTTGCAG -3'

Sequencing Primer
(F):5'- TCCCCAGTAGACAGGCAG -3'
(R):5'- TGTCTCACTTGCAGCAGGG -3'
Posted On2018-05-21