Incidental Mutation 'R6474:Tubal3'
ID516745
Institutional Source Beutler Lab
Gene Symbol Tubal3
Ensembl Gene ENSMUSG00000021216
Gene Nametubulin, alpha-like 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location3918274-3935277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3933107 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 296 (S296T)
Ref Sequence ENSEMBL: ENSMUSP00000021639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021639]
Predicted Effect probably benign
Transcript: ENSMUST00000021639
AA Change: S296T

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021639
Gene: ENSMUSG00000021216
AA Change: S296T

DomainStartEndE-ValueType
Tubulin 56 253 9.39e-66 SMART
Tubulin_C 255 400 8.93e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223035
Meta Mutation Damage Score 0.1100 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Tubal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Tubal3 APN 13 3933015 missense probably damaging 1.00
IGL02053:Tubal3 APN 13 3933159 missense probably damaging 0.97
IGL02120:Tubal3 APN 13 3930675 missense probably damaging 0.96
IGL02426:Tubal3 APN 13 3932750 missense probably damaging 0.99
IGL02548:Tubal3 APN 13 3930554 missense probably benign 0.05
IGL02981:Tubal3 APN 13 3933257 missense probably benign 0.02
R0458:Tubal3 UTSW 13 3933137 missense probably damaging 1.00
R1626:Tubal3 UTSW 13 3932841 missense probably damaging 1.00
R1657:Tubal3 UTSW 13 3933011 missense possibly damaging 0.87
R2084:Tubal3 UTSW 13 3928192 missense possibly damaging 0.62
R3545:Tubal3 UTSW 13 3933560 makesense probably null
R3976:Tubal3 UTSW 13 3932946 missense probably benign
R4700:Tubal3 UTSW 13 3933514 missense probably damaging 0.99
R4722:Tubal3 UTSW 13 3928185 missense probably damaging 1.00
R5617:Tubal3 UTSW 13 3933432 missense probably damaging 1.00
R7049:Tubal3 UTSW 13 3932756 missense probably damaging 1.00
R7082:Tubal3 UTSW 13 3933050 missense possibly damaging 0.56
R7273:Tubal3 UTSW 13 3930675 missense probably damaging 0.96
R7586:Tubal3 UTSW 13 3928198 missense possibly damaging 0.78
Z1088:Tubal3 UTSW 13 3933511 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTGGCATTGAACGTCCTTCC -3'
(R):5'- TGAAACCAGTTGGACACCAATC -3'

Sequencing Primer
(F):5'- GCTAGTATCAACAGGCTGATTGCTC -3'
(R):5'- TCAACAAACTGAACAGAGGTCCTAG -3'
Posted On2018-05-21