Incidental Mutation 'R6474:St3gal1'
ID516747
Institutional Source Beutler Lab
Gene Symbol St3gal1
Ensembl Gene ENSMUSG00000013846
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 1
SynonymsSiat4a, CMP-N-acetylneuraminate: [beta-galactosidase alpha-2,3] sialytransferase, ST3GalI, Siat4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location67102875-67176830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67111346 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 187 (V187A)
Ref Sequence ENSEMBL: ENSMUSP00000155359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092640] [ENSMUST00000229028] [ENSMUST00000229213]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092640
AA Change: V187A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090307
Gene: ENSMUSG00000013846
AA Change: V187A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Glyco_transf_29 80 336 1.7e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000229028
AA Change: V187A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000229213
AA Change: V187A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230150
Meta Mutation Damage Score 0.4530 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi but can be proteolytically processed to a soluble form. Correct glycosylation of the encoded protein may be critical to its sialyltransferase activity. This protein, which is a member of glycosyltransferase family 29, can use the same acceptor substrates as does sialyltransferase 4B. Two transcript variants encoding the same protein have been found for this gene. Other transcript variants may exist, but have not been fully characterized yet. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in altered terminal glycosylation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in St3gal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:St3gal1 APN 15 67112617 missense probably benign 0.03
Benelux UTSW 15 67113785 nonsense probably null
Luxembourg UTSW 15 67111346 missense possibly damaging 0.52
Strasbourg UTSW 15 67106673 missense probably damaging 0.99
R0452:St3gal1 UTSW 15 67109655 splice site probably benign
R0478:St3gal1 UTSW 15 67113730 missense probably damaging 1.00
R0735:St3gal1 UTSW 15 67113687 missense probably benign
R2357:St3gal1 UTSW 15 67113782 missense probably benign 0.01
R5061:St3gal1 UTSW 15 67108229 missense probably benign 0.40
R5199:St3gal1 UTSW 15 67113715 missense probably benign 0.00
R5734:St3gal1 UTSW 15 67106673 missense probably damaging 0.99
R5828:St3gal1 UTSW 15 67113785 nonsense probably null
R6370:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6371:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6373:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6385:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6387:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6388:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6417:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6420:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6421:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6462:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6463:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6469:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6473:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6759:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6760:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6894:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R6963:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7250:St3gal1 UTSW 15 67106729 missense possibly damaging 0.89
R7394:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7588:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7590:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7591:St3gal1 UTSW 15 67111346 missense possibly damaging 0.52
R7860:St3gal1 UTSW 15 67111265 missense probably benign 0.38
R7954:St3gal1 UTSW 15 67112573 missense probably damaging 1.00
R8346:St3gal1 UTSW 15 67113662 missense probably damaging 0.99
R8347:St3gal1 UTSW 15 67113662 missense probably damaging 0.99
R8348:St3gal1 UTSW 15 67113662 missense probably damaging 0.99
Z1177:St3gal1 UTSW 15 67111367 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GAGGAACCTTACGGAACAGC -3'
(R):5'- GTCTGGCCTATGTCTACAAGG -3'

Sequencing Primer
(F):5'- CCCAGCAGGAGTGATACGTTG -3'
(R):5'- AGGTTCCCATTGTACACACGGAG -3'
Posted On2018-05-21