Mutagenetix > Incidental Mutations

Incidental Mutation 'R6474:St3gal1'

516747

Institutional Source

Beutler Lab

Gene Symbol

St3gal1

Ensembl Gene

ENSMUSG00000013846

Gene Name

ST3 beta-galactoside alpha-2,3-sialyltransferase 1

Synonyms

Siat4a, CMP-N-acetylneuraminate: [beta-galactosidase alpha-2,3] sialytransferase, ST3GalI, Siat4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R6474 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67102875-67176830 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 67111346 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 187 (V187A)

Ref Sequence

ENSEMBL: ENSMUSP00000155359 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092640] [ENSMUST00000229028] [ENSMUST00000229213]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092640
AA Change: V187A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000090307
Gene: ENSMUSG00000013846
AA Change: V187A

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Glyco_transf_29	80	336	1.7e-74	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000229028
AA Change: V187A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000229213
AA Change: V187A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229742

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230150

Meta Mutation Damage Score

0.4530

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.0%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi but can be proteolytically processed to a soluble form. Correct glycosylation of the encoded protein may be critical to its sialyltransferase activity. This protein, which is a member of glycosyltransferase family 29, can use the same acceptor substrates as does sialyltransferase 4B. Two transcript variants encoding the same protein have been found for this gene. Other transcript variants may exist, but have not been fully characterized yet. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in altered terminal glycosylation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd8	T	A	8: 71,461,715	N90Y	probably damaging	Het
Alkal1	T	C	1: 6,389,446	V82A	probably damaging	Het
Ascc3	T	C	10: 50,748,836	S1607P	probably benign	Het
Ccny	A	T	18: 9,345,427	L149H	probably damaging	Het
Clptm1	T	C	7: 19,635,837	N383D	possibly damaging	Het
Clrn2	T	A	5: 45,463,732	M156K	probably benign	Het
Coro2b	T	A	9: 62,426,628	H328L	probably benign	Het
Echs1	A	T	7: 140,108,142	M250K	probably benign	Het
Ecsit	A	G	9: 22,074,685	V145A	possibly damaging	Het
Fas	G	A	19: 34,316,569	G108D	probably damaging	Het
Folh1	A	G	7: 86,775,756	W2R	probably damaging	Het
Gba	C	T	3: 89,204,081	P51L	probably benign	Het
Grik2	C	T	10: 49,132,680	M770I	probably benign	Het
Hcst	T	C	7: 30,417,825	N74S	probably damaging	Het
Hdac9	T	A	12: 34,431,991		probably null	Het
Hsfy2	T	A	1: 56,636,991	D129V	probably damaging	Het
Htt	T	C	5: 34,824,895	V941A	probably benign	Het
Naip5	A	G	13: 100,214,663	V1279A	possibly damaging	Het
Neb	T	A	2: 52,280,612	M1683L	probably benign	Het
Nudt21	C	T	8: 94,019,654	V139I	probably benign	Het
Olfr513	T	C	7: 108,755,029	Y58H	probably damaging	Het
Pex2	A	G	3: 5,561,131	F206S	probably damaging	Het
Plek2	C	A	12: 78,896,291	R77L	probably benign	Het
Ppfia1	A	T	7: 144,506,205	D623E	possibly damaging	Het
Ppm1l	T	A	3: 69,553,041	I317N	probably damaging	Het
Prkacb	T	A	3: 146,755,724	T36S	probably damaging	Het
Sphkap	T	A	1: 83,278,823	I115F	probably damaging	Het
Sprtn	G	T	8: 124,899,134	E95*	probably null	Het
Tcap	C	A	11: 98,384,177	Q46K	probably benign	Het
Thada	T	C	17: 84,443,911	I546V	possibly damaging	Het
Tubal3	T	A	13: 3,933,107	S296T	probably benign	Het
Ube3a	A	G	7: 59,287,024	N683D	probably damaging	Het
Vmn2r82	T	G	10: 79,379,037	L285V	possibly damaging	Het
Zfp871	T	C	17: 32,775,673	D157G	possibly damaging	Het

Other mutations in St3gal1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01528:St3gal1	APN	15	67112617	missense	probably benign	0.03
Benelux	UTSW	15	67113785	nonsense	probably null
Luxembourg	UTSW	15	67111346	missense	possibly damaging	0.52
Strasbourg	UTSW	15	67106673	missense	probably damaging	0.99
R0452:St3gal1	UTSW	15	67109655	splice site	probably benign
R0478:St3gal1	UTSW	15	67113730	missense	probably damaging	1.00
R0735:St3gal1	UTSW	15	67113687	missense	probably benign
R2357:St3gal1	UTSW	15	67113782	missense	probably benign	0.01
R5061:St3gal1	UTSW	15	67108229	missense	probably benign	0.40
R5199:St3gal1	UTSW	15	67113715	missense	probably benign	0.00
R5734:St3gal1	UTSW	15	67106673	missense	probably damaging	0.99
R5828:St3gal1	UTSW	15	67113785	nonsense	probably null
R6370:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6371:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6373:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6385:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6387:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6388:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6417:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6420:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6421:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6462:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6463:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6469:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6473:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6759:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6760:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6894:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R6963:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R7250:St3gal1	UTSW	15	67106729	missense	possibly damaging	0.89
R7394:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R7588:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R7590:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R7591:St3gal1	UTSW	15	67111346	missense	possibly damaging	0.52
R7860:St3gal1	UTSW	15	67111265	missense	probably benign	0.38
R7954:St3gal1	UTSW	15	67112573	missense	probably damaging	1.00
R8346:St3gal1	UTSW	15	67113662	missense	probably damaging	0.99
R8347:St3gal1	UTSW	15	67113662	missense	probably damaging	0.99
R8348:St3gal1	UTSW	15	67113662	missense	probably damaging	0.99
Z1177:St3gal1	UTSW	15	67111367	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- GAGGAACCTTACGGAACAGC -3'
(R):5'- GTCTGGCCTATGTCTACAAGG -3'

Sequencing Primer
(F):5'- CCCAGCAGGAGTGATACGTTG -3'
(R):5'- AGGTTCCCATTGTACACACGGAG -3'

Posted On

2018-05-21