Incidental Mutation 'R6474:Zfp871'
ID516748
Institutional Source Beutler Lab
Gene Symbol Zfp871
Ensembl Gene ENSMUSG00000024298
Gene Namezinc finger protein 871
Synonyms9030612M13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32771236-32788287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32775673 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 157 (D157G)
Ref Sequence ENSEMBL: ENSMUSP00000050501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057501] [ENSMUST00000159086]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057501
AA Change: D157G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050501
Gene: ENSMUSG00000024298
AA Change: D157G

DomainStartEndE-ValueType
KRAB 1 42 1.32e0 SMART
ZnF_C2H2 174 196 5.9e-3 SMART
ZnF_C2H2 202 224 6.32e-3 SMART
ZnF_C2H2 230 252 1.47e-3 SMART
ZnF_C2H2 258 280 3.63e-3 SMART
ZnF_C2H2 286 308 1.79e-2 SMART
ZnF_C2H2 314 336 4.79e-3 SMART
ZnF_C2H2 342 364 1.69e-3 SMART
ZnF_C2H2 370 392 2.79e-4 SMART
ZnF_C2H2 398 420 1.23e-5 SMART
ZnF_C2H2 426 448 1.2e-3 SMART
ZnF_C2H2 454 476 5.42e-2 SMART
ZnF_C2H2 482 504 8.6e-5 SMART
ZnF_C2H2 510 532 5.21e-4 SMART
ZnF_C2H2 538 560 3.11e-2 SMART
ZnF_C2H2 566 588 2.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159086
AA Change: D176G

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127178
Gene: ENSMUSG00000024298
AA Change: D176G

DomainStartEndE-ValueType
KRAB 4 61 2.18e-15 SMART
ZnF_C2H2 193 215 5.9e-3 SMART
ZnF_C2H2 221 243 6.32e-3 SMART
ZnF_C2H2 249 271 1.47e-3 SMART
ZnF_C2H2 277 299 3.63e-3 SMART
ZnF_C2H2 305 327 1.79e-2 SMART
ZnF_C2H2 333 355 4.79e-3 SMART
ZnF_C2H2 361 383 1.69e-3 SMART
ZnF_C2H2 389 411 2.79e-4 SMART
ZnF_C2H2 417 439 1.23e-5 SMART
ZnF_C2H2 445 467 1.2e-3 SMART
ZnF_C2H2 473 495 5.42e-2 SMART
ZnF_C2H2 501 523 8.6e-5 SMART
ZnF_C2H2 529 551 5.21e-4 SMART
ZnF_C2H2 557 579 3.11e-2 SMART
ZnF_C2H2 585 607 2.86e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168337
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Other mutations in Zfp871
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Zfp871 APN 17 32775899 missense probably benign
IGL00963:Zfp871 APN 17 32774752 missense probably benign 0.25
IGL01687:Zfp871 APN 17 32775644 missense probably benign 0.00
IGL02170:Zfp871 APN 17 32775688 missense possibly damaging 0.72
IGL02399:Zfp871 APN 17 32774355 missense probably benign 0.18
R0304:Zfp871 UTSW 17 32774434 missense probably damaging 0.99
R1215:Zfp871 UTSW 17 32775972 missense possibly damaging 0.70
R1444:Zfp871 UTSW 17 32774926 missense possibly damaging 0.85
R1754:Zfp871 UTSW 17 32775334 missense probably damaging 1.00
R1913:Zfp871 UTSW 17 32775917 missense possibly damaging 0.53
R2018:Zfp871 UTSW 17 32774777 missense probably damaging 1.00
R2180:Zfp871 UTSW 17 32775301 missense probably damaging 1.00
R2881:Zfp871 UTSW 17 32775433 missense probably damaging 1.00
R4422:Zfp871 UTSW 17 32774833 missense probably benign 0.39
R4422:Zfp871 UTSW 17 32774834 missense probably benign 0.37
R4979:Zfp871 UTSW 17 32775855 missense probably damaging 0.99
R5564:Zfp871 UTSW 17 32775868 missense possibly damaging 0.70
R6228:Zfp871 UTSW 17 32775884 missense possibly damaging 0.50
R6232:Zfp871 UTSW 17 32775520 frame shift probably null
R6233:Zfp871 UTSW 17 32775520 frame shift probably null
R6234:Zfp871 UTSW 17 32775520 frame shift probably null
R7237:Zfp871 UTSW 17 32775315 missense probably damaging 1.00
R7809:Zfp871 UTSW 17 32774852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCGCAACTGAATCCAACG -3'
(R):5'- AAGTGTACTTCTTAAACCTGACCC -3'

Sequencing Primer
(F):5'- ATGAGCGAAGGTTTTCCCAC -3'
(R):5'- TGACCCAAAGCATGAATCGTG -3'
Posted On2018-05-21