Incidental Mutation 'R6474:Fas'
ID 516751
Institutional Source Beutler Lab
Gene Symbol Fas
Ensembl Gene ENSMUSG00000024778
Gene Name Fas cell surface death receptor
Synonyms APO-1, Tnfrsf6, TNFR6, CD95
MMRRC Submission 044607-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.134) question?
Stock # R6474 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 34268066-34305172 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34293969 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 108 (G108D)
Ref Sequence ENSEMBL: ENSMUSP00000025691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025691]
AlphaFold P25446
PDB Structure Structure of the FAS/FADD death domain assembly [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000025691
AA Change: G108D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025691
Gene: ENSMUSG00000024778
AA Change: G108D

DomainStartEndE-ValueType
TNFR 44 78 2.43e0 SMART
TNFR 81 123 3.21e-8 SMART
TNFR 125 161 9.45e-6 SMART
transmembrane domain 170 187 N/A INTRINSIC
DEATH 212 306 2.82e-22 SMART
Meta Mutation Damage Score 0.8223 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. The interaction of this receptor with its ligand allows the formation of a death-inducing signaling complex that includes Fas-associated death domain protein (FADD), caspase 8, and caspase 10. The autoproteolytic processing of the caspases in the complex triggers a downstream caspase cascade, and leads to apoptosis. This receptor has been also shown to activate NF-kappaB, MAPK3/ERK1, and MAPK8/JNK, and is found to be involved in transducing the proliferating signals in normal diploid fibroblast and T cells. Several alternatively spliced transcript variants have been described, some of which are candidates for nonsense-mediated mRNA decay (NMD). The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mutations in this locus affect immune function and homozygotes show varying severity of lymphadenopathy, splenomegaly, lymphocytic infiltrations, elevated immunoglobulin levels, autoantibodies, impaired clonal deletion of T cells, and lupus-like disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,914,359 (GRCm39) N90Y probably damaging Het
Alkal1 T C 1: 6,459,670 (GRCm39) V82A probably damaging Het
Ascc3 T C 10: 50,624,932 (GRCm39) S1607P probably benign Het
Ccny A T 18: 9,345,427 (GRCm39) L149H probably damaging Het
Clptm1 T C 7: 19,369,762 (GRCm39) N383D possibly damaging Het
Clrn2 T A 5: 45,621,074 (GRCm39) M156K probably benign Het
Coro2b T A 9: 62,333,910 (GRCm39) H328L probably benign Het
Echs1 A T 7: 139,688,055 (GRCm39) M250K probably benign Het
Ecsit A G 9: 21,985,981 (GRCm39) V145A possibly damaging Het
Folh1 A G 7: 86,424,964 (GRCm39) W2R probably damaging Het
Gba1 C T 3: 89,111,388 (GRCm39) P51L probably benign Het
Grik2 C T 10: 49,008,776 (GRCm39) M770I probably benign Het
Hcst T C 7: 30,117,250 (GRCm39) N74S probably damaging Het
Hdac9 T A 12: 34,481,990 (GRCm39) probably null Het
Hsfy2 T A 1: 56,676,150 (GRCm39) D129V probably damaging Het
Htt T C 5: 34,982,239 (GRCm39) V941A probably benign Het
Naip5 A G 13: 100,351,171 (GRCm39) V1279A possibly damaging Het
Neb T A 2: 52,170,624 (GRCm39) M1683L probably benign Het
Nudt21 C T 8: 94,746,282 (GRCm39) V139I probably benign Het
Or5e1 T C 7: 108,354,236 (GRCm39) Y58H probably damaging Het
Pex2 A G 3: 5,626,191 (GRCm39) F206S probably damaging Het
Plek2 C A 12: 78,943,065 (GRCm39) R77L probably benign Het
Ppfia1 A T 7: 144,059,942 (GRCm39) D623E possibly damaging Het
Ppm1l T A 3: 69,460,374 (GRCm39) I317N probably damaging Het
Prkacb T A 3: 146,461,479 (GRCm39) T36S probably damaging Het
Sphkap T A 1: 83,256,544 (GRCm39) I115F probably damaging Het
Sprtn G T 8: 125,625,873 (GRCm39) E95* probably null Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Tcap C A 11: 98,275,003 (GRCm39) Q46K probably benign Het
Thada T C 17: 84,751,339 (GRCm39) I546V possibly damaging Het
Tubal3 T A 13: 3,983,107 (GRCm39) S296T probably benign Het
Ube3a A G 7: 58,936,772 (GRCm39) N683D probably damaging Het
Vmn2r82 T G 10: 79,214,871 (GRCm39) L285V possibly damaging Het
Zfp871 T C 17: 32,994,647 (GRCm39) D157G possibly damaging Het
Other mutations in Fas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fas APN 19 34,296,018 (GRCm39) missense probably damaging 1.00
IGL01677:Fas APN 19 34,296,218 (GRCm39) missense probably benign 0.09
IGL01834:Fas APN 19 34,296,003 (GRCm39) missense probably benign 0.33
IGL02130:Fas APN 19 34,292,695 (GRCm39) missense probably benign 0.01
IGL02424:Fas APN 19 34,304,434 (GRCm39) missense probably damaging 1.00
IGL02532:Fas APN 19 34,293,999 (GRCm39) missense probably damaging 0.99
IGL02569:Fas APN 19 34,297,962 (GRCm39) missense possibly damaging 0.93
amarena UTSW 19 34,296,049 (GRCm39) missense probably benign 0.01
bing UTSW 19 34,293,969 (GRCm39) missense probably damaging 1.00
cherry UTSW 19 34,304,540 (GRCm39) missense probably damaging 0.99
P0021:Fas UTSW 19 34,284,610 (GRCm39) missense probably damaging 0.98
R0525:Fas UTSW 19 34,296,727 (GRCm39) missense probably damaging 1.00
R0588:Fas UTSW 19 34,304,540 (GRCm39) missense probably damaging 0.99
R1465:Fas UTSW 19 34,294,013 (GRCm39) missense probably damaging 1.00
R1465:Fas UTSW 19 34,294,013 (GRCm39) missense probably damaging 1.00
R2077:Fas UTSW 19 34,297,953 (GRCm39) splice site probably benign
R2283:Fas UTSW 19 34,284,649 (GRCm39) missense probably damaging 1.00
R4154:Fas UTSW 19 34,296,228 (GRCm39) missense possibly damaging 0.72
R5252:Fas UTSW 19 34,294,043 (GRCm39) missense probably damaging 0.99
R5943:Fas UTSW 19 34,297,987 (GRCm39) critical splice donor site probably null
R6837:Fas UTSW 19 34,284,564 (GRCm39) missense probably damaging 0.97
R7640:Fas UTSW 19 34,284,564 (GRCm39) missense possibly damaging 0.46
R8507:Fas UTSW 19 34,304,626 (GRCm39) missense probably benign 0.00
R8837:Fas UTSW 19 34,296,049 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGGATTATCTACTCACCAAAGGC -3'
(R):5'- TCTCAGAAGGCAGGATGTTCC -3'

Sequencing Primer
(F):5'- AAGTACACTGCAGCTGTCTTCAG -3'
(R):5'- AAGGCAGGATGTTCCATCTC -3'
Posted On 2018-05-21